A kind of novel chimeric dna polymerase and preparation method thereof

A polymerase and exonuclease technology, applied in the field of DNA polymerase, can solve the problems of low continuous synthesis ability, slow amplification and extension speed of Pfu enzyme, and low error probability.

Active Publication Date: 2022-04-26
NOVOPROTEIN SCI INC
View PDF5 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0003] However, the advantages of a high-fidelity DNA polymerase are offset by its relatively low processivity, which reduces the yield of DNA amplification products
Pfu DNA polymerase (Pfu DNA polymerase), also known as Pfu polymerase, was found in the thermophilic archaeal organism Pyrococcus. Among all thermostable polymerases, the error rate of Pfu DNA polymerase is the lowest, and the error rate about 2.0x10 -6 However, the Pfu enzyme amplification elongation speed is slow (25nts / s), and the amplification yield is low (~20nts), which brings inconvenience to many users

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A kind of novel chimeric dna polymerase and preparation method thereof
  • A kind of novel chimeric dna polymerase and preparation method thereof
  • A kind of novel chimeric dna polymerase and preparation method thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0040] Embodiment 1: Design of chimeric DNA polymerase

[0041] Pfu and KOD have very different phenotypic characteristics, in particular, in terms of elongation rate, processivity, and error rate, Pfu has the lowest error rate among all thermostable polymerases, with an error rate of about 2.0 x10 -6, KOD is a DNA polymerase with high amplification ability, the amplification speed is 2 times that of Taq enzyme, 6 times that of Pfu enzyme, and the amplification yield is higher (~300nts) (takagi et al.1997).

[0042] Therefore, the chimeric DNA polymerase of this example is a chimeric combination of these two enzymes, which exhibits a lower error rate (0.93×I0-6) than Pfu, and has processivity and elongation comparable to KOD rate (about 300nt / s and 106-138nt / s, respectively). The nucleotide sequence of the chimeric DNA polymerase provided by the present invention is SEQ ID No.3, specifically the N-terminal domain nucleotide sequence (1-390&981-1104) of the KOD enzyme, the pa...

Embodiment 2

[0043] Example 2: Purification of Chimeric DNA Polymerase

[0044] Inoculate the obtained expression strain 1:100 into LB medium, culture at 37°C, 250rmp shaking until OD600=2.5, add 0.1mM IPTG to induce expression, in order to increase the ratio of protein soluble expression, reduce the culture temperature to 16 ℃, low temperature induced expression overnight (16h), 5k centrifugation harvested bacteria.

[0045] 1. Bacteria destruction: the total amount of bacteria is mixed with the bacteria-breaking buffer (50mM Tis-Hcl, pH 8.0) at 1:10, that is, 1g of bacteria is added to 10ml of buffer, and the bacteria are broken by ultrasonic. The supernatant was collected by centrifugation at 8000rpm for 30min.

[0046] 2. Mix the thermal denaturation buffer (25mM Tris, 1mM EDTA, 0.5% Tween20, pH8.0,) into the ultrasonically sterilized solution at a ratio of 1:1, mix well and put it in a water bath at 75°C for 30 minutes to denature. The supernatant was collected by centrifugation at ...

Embodiment 3

[0049] Example 3: Detection of extension rate of chimeric DNA polymerase

[0050] The chimeric high-fidelity DNA polymerase, Pfu DNA polymerase and Kod DNA polymerase prepared in Example 1 of the present invention were amplified using λDNA as a template, and the amplified fragment was 3000 bp. The result is as image 3 Shown: Lnae1 is a chimeric DNA polymerase.

[0051] The reaction system and procedure are as follows:

[0052]

[0053]

[0054] Example 3: Fidelity Detection of Chimeric DNA Polymerase

[0055] 1) Amplify the LacIZα gene, the primer sequence is as follows:

[0056] F: GTTTTCCCAGTCACGAC

[0057] R: GGTATCTTTATAGTCCTGTCG

[0058] 2) Endonuclease digestion to obtain a linearized vector:

[0059] 3) Ligate the obtained gene to the vector, transform the ligated product into the host strain DH5a for expression, culture it on a medium containing x-gal and IPTG, count the number of blue and white spots, and calculate the fidelity.

[0060] Calculated accor...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The present invention develops a novel chimeric DNA polymerase, and in some embodiments, the chimeric polymerase designed according to the present invention has processivity, elongation rate, and thermostability substantially similar to the first DNA polymerase and a fidelity substantially similar to that of the second DNA polymerase. The first DNA polymerase of the present invention is KOD polymerase SEQ ID No.1, and the second DNA polymerase is Pfu polymerase SEQ ID No.2. The technical solution of the present invention utilizes the switching of functional regions in high-fidelity DNA polymerases to combine the expected functional characteristics of different DNA polymerases. Among other things, the present invention provides robust, fast and accurate DNA polymerases for DNA amplification, synthesis, detection, sequencing and other important recombinant DNA techniques. The innovative high-fidelity DNA polymerase invented is a high-fidelity DNA polymerase with high fidelity, high processivity, high elongation rate, thermostability, and salt tolerance.

Description

technical field [0001] The invention belongs to the field of molecular and cell biology, in particular to DNA polymerase. Background technique [0002] DNA polymerase, also known as DNA-dependent DNA polymerase (DNApol), uses DNA single strand as a template, and uses 4 kinds of deoxynucleotides as substrates to replicate and synthesize a strand with the template from the 5' end A new strand of DNA with a complementary sequence. High-fidelity DNA polymerase has the activity of 3' to 5' exonuclease. If there is a mismatched base during PCR amplification, it can cut it off, thus ensuring the accuracy of amplification. Common DNA polymerases (such as taqDNA polymerase) have a mismatch rate of 10 -5 , while the high-fidelity DNA polymerase mismatch rate can be reduced to 10 -6 even 10 -7 , which greatly reduces the possibility of error; it is suitable for experiments that require high fidelity of PCR, such as gene screening, sequencing, mutation detection, etc. [0003] Howe...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C12N9/12C12N15/54
CPCC12N9/1252C12Y207/07007
Inventor吴亚会位小丫李新瑞任加庆臧赢
OwnerNOVOPROTEIN SCI INC