Primer set and kit for detecting four mutations of SLC25A13 gene and application thereof
A technology for detection kits and detection primers, which is applied in the direction of recombinant DNA technology, microbial measurement/inspection, biochemical equipment and methods, etc., can solve the problem of clinical detection of no disease, etc., and achieve low cost, high sensitivity and high specificity Effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0068] Example 1 Primer Sets and Probes
[0069] 1.1 For the type I mutation of SLC25A13, search the sequence in NCBI and design primers and probes. A total of 2 primers and 1 Taqman probe were designed.
[0070] SLC25A13 type I primer F: CCAAACTGAAGGCTATACTGA (SEQ ID NO.1);
[0071] SLC25A13 type I primer R: CCTCTTCCAGAGGAGCA (SEQ ID NO.2);
[0072] SLC25A13 Type I Probe:
[0073] 5'FAM-TTGTTTTTCCCCTACAGACGTATGACCTTAGCAG-3'BHQ1 (SEQ ID NO. 3).
[0074] 1.2 For the type III mutation of SLC25A13, search the sequence in NCBI and design primers and probes. A total of 2 primers and 1 Taqman probe were designed.
[0075] SLC25A13 type III primer F: GACTGAGATGGTGTTGTGT (SEQ ID NO.4);
[0076] SLC25A13 type III primer R: ACTCCGCTGTAAGTGGTT (SEQ ID NO.5);
[0077] SLC25A13 Type III probe:
[0078] 5'CY5-GAGATTACAGGTGGCTGCCCGGGGAGATTACAG-3'BHQ2 (SEQ ID NO. 6).
[0079] 1.3 For the X-type mutation of SLC25A13, search the sequence in NCBI and design primers and probes. A total of ...
Embodiment 2
[0095] An embodiment of the detection kit of the Citrin deficiency disease-causing gene mutation of the present invention, comprising the primer set of embodiment 1, PCR buffer, Mg 2+ , dNTPs and DNA polymerase; PCR buffer contains Tris-HCl and KCl.
[0096] In this embodiment, the SLC25A13 genotype of Citrin deficiency patients and normal people was detected by using the detection kit for the mutation of the Citrin deficiency disease-causing gene; specifically, when the detection kit is used, the following aspects are included:
[0097] 1. The components of the PCR reaction system are shown in Table 1:
[0098] Table 1 PCR reaction system
[0099]
[0100] 2. The PCR reaction program is shown in Table 2:
[0101] Table 2 PCR reaction program
[0102]
[0103] 3. Genotyping criteria
[0104] 3.1 Amplification curve
[0105] When the amplification curve is smooth, showing an "S" shape, and the Ct value is less than or equal to 30, the genotyping can be judged.
[01...
PUM
| Property | Measurement | Unit |
|---|---|---|
| melting point | aaaaa | aaaaa |
| melting point | aaaaa | aaaaa |
| melting point | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
Login to View More 


