Kit for quantitatively detecting solanum tuberosum component based on microdroplet digital PCR (Polymerase Chain Reaction) and application of kit

A quantitative detection and micro-droplet digital technology, applied in the field of molecular biology detection, can solve the problems of inability to obtain accurate quantitative measurement results, fail to meet the needs of the industry, and cumbersome operation steps, and achieve wide application range, good specificity, and easy operation steps. easy effect

Inactive Publication Date: 2019-04-26
INSPECTION & QUARANTINE TECH CENT OF GUANGDONG ENTRY EXIT INSPECTION & QUARANTINE BUREAU
View PDF3 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Although the above method can realize the detection of potato components, the operation steps are cumbersome and time-consuming, and accurate quantitative determination results cannot be obtained, which cannot meet the needs of the industry

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Kit for quantitatively detecting solanum tuberosum component based on microdroplet digital PCR (Polymerase Chain Reaction) and application of kit
  • Kit for quantitatively detecting solanum tuberosum component based on microdroplet digital PCR (Polymerase Chain Reaction) and application of kit
  • Kit for quantitatively detecting solanum tuberosum component based on microdroplet digital PCR (Polymerase Chain Reaction) and application of kit

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0054] specificity test

[0055] Genomic DNA was extracted from potato, sweet potato, cassava, yam, taro, eggplant, carrot, tomato, celery, rice, soybean and barley crops, using the upstream primer of the ST-LS1 gene (tgctctttctatatgatctcggataatt, SEQID No.1), ST The downstream primer of LS1 gene (aggacaaaaagaaaaaactgattggt, SEQ ID No.2) and the probe of ST-LS1 gene (aactggtctccaacaggcaacaaccca, SEQ ID No.3) were amplified by fluorescent quantitative PCR. The reaction program of the fluorescent quantitative PCR is as follows: 95°C, 5min, 1°C / s; 94°C, 15s, 1°C / s, 60°C, 1min, 1°C / s, a total of 40 cycles; 98°C, 10min, 1°C / s.

[0056] Among the above 12 crops, only potato samples were specifically detected (potatoes with specific S-shaped amplification curves), and no other crops were detected (see figure 1 ). This shows that the primer probe designed in the present invention is specific to the detection of potato and has good specificity.

Embodiment 2

[0058] Linear relationship between potato mass (mg) and copy number concentration (copies / μL)

[0059] Weigh 5mg, 15mg, 30mg, 40mg, 50mg of gradient quality potato flour samples, use Wizard GenomicDNApurification kit (Promega, A1120) to extract genomic DNA, use 20μL digital PCR reaction system (2×ddPCR TM 10 μL of master mix; 0.5 μL of upstream primers with a concentration of 10 μmol / μL, 0.5 μL of downstream primers with a concentration of 10 μmol / μL, 0.4 μL of probes with a concentration of 10 μmol / μL, 2 μL of DNA templates, and water up to 20 μL. ddPCR reaction conditions are: 95°C, 5min (1°C / s); 94°C, 15s (1°C / s), 60°C, 1min (1°C / s), a total of 40 cycles; 98°C, 10min (1°C / s), and store the reaction product at 12°C. After the amplification, the 96-well plate was placed in a droplet analyzer to read the fluorescence signal, and the experimental data was analyzed with QuantaSoftV1.3.2 software.

[0060] The obtained data are shown in Table 1, and the linear relationship dat...

Embodiment 3

[0064] Determination of the Limit of Detection (LOD) and Limit of Quantification (LOQ) of Potato DNA Concentration

[0065] Using DNA concentration gradients of 21ng / μL, 4.2ng / μL, 0.84ng / μL, 0.17ng / μL and 0.06ng / μL, each gradient has three parallels, and the potato DNA concentration copy number test results are shown in Table 2. The heat map of the test results of potato DNA concentration and copy number is shown in image 3 . Judgment conditions are: LOQ is based on the detected copy number concentration at which the RSD of the test result is less than 25%, and LOD is based on the copy number concentration that can be detected in no less than 9 out of 10 parallels.

[0066] Table 2 Potato DNA concentration copy number test results

[0067]

[0068] Table 3 shows the LOD and LOQ test results of 10 parallel groups when the DNA concentration is 0.17 and 0.06 ng / μL respectively. Figure 4 is the heat map of the potato DNA concentration gradient LOD and LOQ test.

[0069] Tab...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a kit for quantitatively detecting a solanum tuberosum component based on a microdroplet digital PCR (Polymerase Chain Reaction) and application of the kit, and belongs to the field of molecular biology detection. The kit for quantitatively detecting the solanum tuberosum component based on the microdroplet digital PCR comprises an upstream primer of an ST-LS1 gene, a downstream primer of the ST-LS1 gene and a probe of the ST-LS1 gene. The kit is applied to quantitative detection of the solanum tuberosum component in a sample. According to a microdroplet digital PCR method for quantitatively detecting the solanum tuberosum component, a solanum tuberosum specificity single-copy species gene ST-LS1 fluorescence signal is detected by utilizing a digital PCR system; solanum tuberosum specificity single-copy species gene ST-LS1 copy number concentration is measured; and the content of the solanum tuberosum component is calculated according to a linear relation betweenthe copy number concentration (copy number / muL) and the mass of solanum tuberosum (mg). The kit provided by the invention is capable of performing specificity quantitative detection on the solanum tuberosum component, and has the characteristics of simplicity and convenience, rapidness, and high detection sensitivity.

Description

technical field [0001] The invention belongs to the field of molecular biology detection, in particular to a kit for quantitative detection of potato components based on droplet digital PCR and an application thereof. Background technique [0002] Potato (Solanum tuberosum) is rich in nutrients such as dietary fiber, vitamins, minerals and essential amino acids. It is the fourth largest staple food crop in the world. There are more and more varieties of potato products on the market. Due to the great difference in the price of potato or grain flour from different sources, some of them differ by more than 10 times. Powders are difficult to identify with the naked eye, which provides opportunities for some unscrupulous merchants to speculate and make profits. In order to ensure the healthy development of the potato staple food product market, the establishment of an accurate quantitative detection method for potato components is conducive to satisfying its quality testing and...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12Q1/6895C12Q1/6851
CPCC12Q1/6851C12Q1/6895C12Q2531/113C12Q2563/159C12Q2537/16
Inventor李志勇刘二龙吕英姿刘婧文关丽军董旭婉
OwnerINSPECTION & QUARANTINE TECH CENT OF GUANGDONG ENTRY EXIT INSPECTION & QUARANTINE BUREAU