Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Primer and probe for detecting fusarium oxysporum f.sp cucumerinum and application of primer and probe

A technology of cucumber specialization type and Fusarium oxysporum, applied in the agricultural field, can solve the problems of poor accuracy, unable to identify special type, unable to quantitatively analyze pathogenic bacteria, etc., and achieve the effect of good linear relationship

Pending Publication Date: 2022-02-18
INST OF PLANT PROTECTION HEBEI ACAD OF AGRI & FORESTRY SCI
View PDF3 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The method of molecular biology includes the use of ITS1 and ITS4 primers for common PCR. This method needs to be combined with phylogenetic tree analysis, and can only identify species, but cannot identify specialized types, and the accuracy is poor
In addition, some studies reported using specific primers to identify the cucumber-specific type of Fusarium oxysporum by common PCR method, however, this method could not carry out quantitative analysis of the identified pathogenic bacteria

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Primer and probe for detecting fusarium oxysporum f.sp cucumerinum and application of primer and probe
  • Primer and probe for detecting fusarium oxysporum f.sp cucumerinum and application of primer and probe
  • Primer and probe for detecting fusarium oxysporum f.sp cucumerinum and application of primer and probe

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0031] Embodiment 1 design specific primer, probe

[0032] The present invention selects a conservative sequence in the HPEG (hypothetical protein-encoding gene) sequence in the genome of Fusarium oxysporum cucumber-specific type through bioinformatics analysis, and its nucleotide sequence is shown in SEQ ID NO.4:

[0033]CCAACAAACAGAGCAAAACTAATAGCACGTAGAACCGCCGTCCTTGGCAGTAATCTTGGGCTTCGTAGTATCGATAGCGCCATTGACAACTGGGTAATATCCACCCTTAGCTAGATCCTTGCAGTTGTTGTACCATC

[0034] The present invention designs specific primers and probes for this sequence:

[0035] FOC 3F: 5'-GATGGTACAACAACTGCAAGGA-3';

[0036] FOC 3R: 5'-CCAACAAACAGAGCAAAACTAA-3';

[0037] FOC probe3: FAM5'-AGCACGTAGAACCGCCGTCCTT-3'HBQ1.

[0038] At the same time, the software provides three pairs of primers for the above sequence design, the names and sequences are as follows:

[0039] Primer name Sequence (5'-3') Foc F1 TCACTTGACTTCACTTCACTTCAC Foc R1 GATCTCTGGCCATAACGG Foc F2 CCGTTATG...

Embodiment 2

[0042] Embodiment 2 examines the specificity of primer

[0043] FOC 3F and FOC 3R were used as primers, FOC probe3 was used as a probe, and 27 different pathogen DNAs were used as templates for qPCR amplification. 27 different pathogens including Fusarium oxysporum wilt specific; Fusarium oxysporum specific watermelon; Fusarium oxysporum specific melon; ;Fusarium oxysporum capsicum specialization type; Fusarium oxysporum specialization type sunflower; Fusarium graminearum; Fusarium pseudograminea; Rhizoctonia solani; Fusarium laminarum; Fusarium equisetum; Fusarium glucosporum; Black spot fungus; Verticillium black and white; Botrytis cinerea.

[0044] The PCR amplification system is a 25 μL system, and the system is as follows: rTaq enzyme 0.5 μL, Mg 2+ 3 μL, 2.5 μL of 10×Buffer, 2.0 μL of dNTP, 1.0 μL of each specific primer and probe, 5 μL of DNA template, 5 μL of BSA, ddH 2 O 4 μL.

[0045] The qPCR amplification conditions were pre-denaturation at 95°C for 1 min; den...

Embodiment 3

[0050] Embodiment 3 builds standard curve

[0051] Using the cucumber-specific genome of Fusarium oxysporum as a template, amplified with the primers obtained from the above screening, the amplified product was purified and cloned into the vector pMD18-T, and transformed into Escherichia coli DH5α by heat shock transformation. reproduce in cells. Colonies containing recombinant plasmids were screened on LB culture dishes with ampicillin antibiotics and verified by PCR to obtain recombinant plasmids containing specific sequences.

[0052] A plasmid extraction kit was used to extract the recombinant plasmid, and the extracted recombinant plasmid was digested with the endonuclease EcoRI. The digested product was subjected to agarose gel electrophoresis and then gel-cut to recover the corresponding fragments. The fragments were recovered using the Promega Gel Extaction Kit. The Mofei Nanodrop 2000 spectrophotometer measures the DNA concentration of the recombinant plasmid, and ca...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the technical field of agriculture, and particularly relates to a primer and a probe for detecting fusarium oxysporum f.sp cucumerinum and application of the primer and the probe. According to the primer and the probe for detecting fusarium oxysporum f.sp cucumerinum, the nucleotide sequence of the primer is shown as SEQ ID NO.1 and SEQ ID NO.2, and the nucleotide sequence of the probe is shown as SEQ ID NO.3. A conserved sequence in an HPEG sequence in a genome of the fusarium oxysporum f.sp cucumerinum is selected, the specific primer and the probe are designed according to the sequence, the designed specific primer and probe can amplify a single target fragment without no amplification signal in other bacteria. Therefore, specific detection of the fusarium oxysporum f.sp cucumerinum can be realized by utilizing the primer and the probe.

Description

technical field [0001] The invention belongs to the technical field of agriculture, and in particular relates to a primer, a probe and an application thereof for detecting the cucumber-specific type of Fusarium oxysporum. Background technique [0002] Cucumber wilt is a systematic soil-borne disease of cucumber caused by Fusarium oxysporum f.sp.cucumerinum. Because soil-borne diseases are relatively less affected by external environmental factors such as climate, the number of pathogenic bacteria in soil is often the main determinant of disease prevalence. Therefore, it is of great significance to construct primers and probes that can specifically detect the cucumber-specific type of Fusarium oxysporum and quantitatively detect the number of pathogenic bacteria in soil for the prediction and effective control of such diseases. [0003] At present, the methods for detecting the cucumber-specific type of Fusarium oxysporum mainly include traditional methods and molecular biol...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/6895C12N15/11C12R1/77
CPCC12Q1/6895
Inventor 董丽红马平郭庆港李社增王培培鹿秀云赵卫松张晓云苏振贺
Owner INST OF PLANT PROTECTION HEBEI ACAD OF AGRI & FORESTRY SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com