Method for detecting DNA or protein based on double-amplification method

A protein and dual technology, applied in biochemical equipment and methods, measurement devices, and microbial assay/inspection, etc., can solve the problems of incomplete guanine quadruplex sequence sealing, increased design difficulty, high background signal, etc.

Inactive Publication Date: 2019-11-19
NAT UNIV OF DEFENSE TECH
View PDF5 Cites 7 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the reported method based on guanine quadruplex is to present the sequence of guanine quadruplex as a hairpin, double-strand closure, or as the complementary strand of the template. If the previous treatment of the probe DNA is not appropriate , resulting in incomplete blockade of the guanine quadruplex sequence, resulting in higher background signal
However, the guanine quadruplex generated by the template increases the design difficulty to a certain extent because the complementary sequence is introduced into the design during the design process.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for detecting DNA or protein based on double-amplification method
  • Method for detecting DNA or protein based on double-amplification method
  • Method for detecting DNA or protein based on double-amplification method

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0058] Embodiment 1 detects target DNA

[0059] 1. Target identification

[0060] Recognition probe 5'-AAA GGA TCG AAT AAG AGG TCC TTC-PO 4 3- 3' (SEQ ID NO. 1);

[0061] Target nucleic acid 5'-GAA GGA CCT CTT ATT CGATCC TTT-3' (SEQ ID NO.2);

[0062] In a 600 μL centrifuge tube, add 1 μL of 15 μM recognition probe, 1 μL of 100 nM target nucleic acid, 2 μL of 5×NBE buffer 4 (100 mM Tris-Ac, 50 mM Mg(Ac) 2 , 250mM KAc, pH 7.9) buffer solution, and 6 μL ultrapure water, mixed with a 10 μL pipette gun, and incubated in a 58°C water bath for 5 minutes.

[0063] 2. Endonuclease amplification detection

[0064] After 5 minutes, add 8 units of Nt.AlwI to the centrifuge tube and incubate at this temperature for 2 hours. Add the endonuclease and incubate at 37°C for 2 hours; during incubation, the endonuclease will cut the probe and release the DNA fragment containing 3'OH 5'-AAA GGA TCG AAT-OH-3'(SEQ ID NO.3). After 2 hours, the nicking reaction was terminated by incubating th...

Embodiment 2

[0069] Embodiment 2 detects thrombin

[0070] 1. Target identification

[0071] The identification probes are:

[0072] 5'-AGTCCGTGGTAGGGCAGGTTGGGGTGACTGCTGATTTTTGAGCCTCAGCAGTCACCC-PO 4 3- 3' (SEQ ID NO.4);

[0073] The amplification probe is: 5'-TTTTTAGACTGCTGAGGC-PO 4 3 -3' (SEQ ID NO.5);

[0074] The specific sequences of the recognition probe and amplification probe are designed by the applicant according to the characteristics of thrombin itself. The recognition probe includes three parts, AGTCCGTGGTAGGGCAGGTTGGGGTGACT (5'-3') is a thrombin nucleic acid aptamer sequence, which can recognize and bind thrombin. The second part is the restriction endonuclease nicking site of CCTCAGC (5'-3'), which is used as the signal initiation part. The third part is the hairpin structure formed after the recognition probe is annealed, which contains a 13-base complementary stem, which acts as a closed hairpin. The sequence length of the amplified probe is not more than 20bp, and t...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
wavelengthaaaaaaaaaa
Login to View More

Abstract

The invention discloses a method for detecting a target DNA or protein based on a double-amplification method, wherein the method comprises the following steps: (1) incubating a sample to be tested with a probe, wherein the incubation condition comprises the temperature of 20-40 DEG C and the time of 0.5-1 h; (2) adding endonuclease, wherein the incubation condition comprises the temperature of 20-40 DEG C and the time of 1-3 h; and during incubation, cutting the probe by the endonuclease and releasing a DNA fragment containing 3'OH; (3) adding terminal transferase (TdT) and dNTP, and generating a long-chain DNA of G-quadruplex at a gap end of DNA; (4) adding the solution after reaction in the step (3) to an MES buffer and hemin, and incubating for 15-60 min; and then adding ABTS and H2O2,and carrying out UV detection. The target DNA or protein is detected according to the strength of absorption light signals. The method is a new simple method for signal amplification and sensitive detection of biomolecules.

Description

technical field [0001] The invention relates to the field of biotechnology, and in particular relates to a biomolecule detection method for detecting trace amounts of DNA or protein by a double amplification method. Background technique [0002] Trace amounts of nucleic acids or proteins are common biomarkers, and their specific and sensitive detection is of great significance for mutation analysis and early diagnosis of diseases. However, detection of low expression level biomarkers is quite challenging. Existing biomarker detection methods have some shortcomings in practical application. For example, Northern Blotting has relatively low sensitivity and time-consuming operation. Immunological methods require a long test cycle and relatively high medical conditions. The obvious advantage in the sensitivity of polymerase chain reaction, but possible replication errors and strict experimental conditions limit its application. Therefore, sensitive detection of specific biom...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12Q1/682G01N33/573
CPCC12Q1/682G01N33/573
Inventor刘卓靓王建方陶呈安邹晓蓉王芳黄坚李玉姣阳绪衡
OwnerNAT UNIV OF DEFENSE TECH