Check patentability & draft patents in minutes with Patsnap Eureka AI!

A Molecular Marker Related to Sheep Tail Fat Weight and Its Application

A technology of molecular markers and sheep tail fat, which is applied in the direction of recombinant DNA technology, microbial measurement/testing, biochemical equipment and methods, etc., can solve the problems of increasing the cost of breeding

Active Publication Date: 2022-03-25
GANSU AGRI UNIV
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

In addition, with large-scale breeding, continuous expansion of herdsmen’s settlements, continuous improvement of forage planting and other supporting facilities, excessive tail fat deposition is of little significance to sheep itself, and considering the cost of breeding, the production of 1kg of fat-consuming feed Grass can produce 2kg lean meat, obviously too much fat deposition will also increase the cost of farming

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A Molecular Marker Related to Sheep Tail Fat Weight and Its Application
  • A Molecular Marker Related to Sheep Tail Fat Weight and Its Application
  • A Molecular Marker Related to Sheep Tail Fat Weight and Its Application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0040] Embodiment 1 Amplification of ADRA2A gene

[0041] (1) Primer design

[0042] Using the sheep ADRA2A gene DNA (GenBank accession number: NC_019479.2) as a template, a pair of primers M-F and M-R were designed using Primer 5.0 software. The primer sequences are as follows

[0043] ADRA2A:

[0044] Forward primer M-F: 5'-GGTGGTCATCGGCGTGTT-3' (SEQ ID NO: 2),

[0045] Reverse primer M-R: 5'-CCCTCCCAGCCAGTTCTTT-3' (SEQ ID NO: 3).

[0046] (2) Amplification and sequencing of ADRA2A gene

[0047] The total volume of the PCR reaction is 25 μL, including 1 μL of DNA template, 12.5 μL of 2×PCR Master Mix, 0.8 μL of upstream primer, 0.8 μL of downstream primer, ddH 2 O 10 μL. The PCR amplification program was: pre-denaturation at 94°C for 3 min, denaturation at 94°C for 30 s, annealing at 63.7°C for 30 s, extension at 72°C for 30 s, 35 cycles, and finally extension at 72°C for 10 min. The PCR reaction product was detected by 1.5% agarose gel electrophoresis, and a 411bp spe...

Embodiment 2

[0050] Embodiment 2, establishment of genotyping detection method

[0051] (1) KASPar primer sequence design

[0052] A KASPar primer pair is designed for the C / A polymorphic site of the amplified fragment in Example 1, so as to be used for the specific detection of the polymorphic site, and the nucleotide sequence of the KASPar primer pair is:

[0053] Forward primer A1 for detection of AlleleA:

[0054] GAAGGTGACCAAGTTCATGCTAGCGGACTCCACACTCACACT (SEQ ID NO: 4);

[0055] Forward primer A2 used to detect AlleleC:

[0056] GAAGGTCGGAGTCAACGGATTGCGGACTCCACACTCACACG (SEQ ID NO: 5);

[0057] Universal reverse primer C: CGCGCCTTCAAGAAGATCCTCTG (SEQ ID NO: 6).

[0058] The above primers were synthesized by entrusting Beijing Sangong Bioengineering Co., Ltd., and the primers of each group in the KASPar primer pair were diluted to 10 μmol / L, and mixed according to the volume ratio of 12:12:30 (primer A1: primer A2: primer C) Evenly reserve.

[0059] (2) DNA quality control

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a molecular marker related to sheep tail fat weight, as well as a detection method and application of the molecular marker. The present invention finds that there is a C / A polymorphic site in the 217th position of the amplified fragment through PCR amplification and sequence analysis of the sheep ADRA2A gene, and further uses the KASPar primer pair to analyze the polymorphic site of 161 Hu sheep. Points were detected and a least squares model was established, and the correlation analysis between genotype and tail fat weight was carried out, and finally it was determined that the amplified ADRA2A gene fragment of the present invention can be used as a molecular marker related to sheep tail fat weight. The molecular marker of the invention can be used for the breeding of low-fat sheep and the cultivation of new varieties of low-fat high-quality mutton sheep, provides genetic engineering means for the genetic improvement of sheep meat quality, and has great practical application value.

Description

technical field [0001] The invention belongs to the technical field of molecular marker preparation, and specifically relates to ADRA2A gene fragments as molecular markers affecting sheep tail fat weight and application thereof. Background technique [0002] Sheep were the first domesticated herbivorous livestock, dating back to the end of the Mesolithic period 11,000 years ago. During the long domestication process, animal behavior, body shape and appearance, as well as important economic traits have undergone great changes due to artificial selection and the influence of the natural environment. Studies have shown that wild sheep belonged to thin-tailed sheep at first, but due to artificial domestication and natural selection, some thin-tailed sheep evolved into fat-tailed sheep. The fat tail (buttocks) trait of sheep is a necessary trait for survival in harsh natural environments. In harsh ecological environments such as freezing and nutrient deficiencies, fat tail sheep...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12Q1/6888C12N15/11
CPCC12Q1/6888C12Q2600/124C12Q2600/156
Inventor 王维民张德印张小雪李冲喇永富李国泽
Owner GANSU AGRI UNIV
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More