Unlock instant, AI-driven research and patent intelligence for your innovation.

Long non-coding RNA and application of long non-coding RNA in diagnosis of preeclampsia and preparation of target drug for curing preeclampsia

A preeclampsia, non-coding technology, applied in the field of genetic engineering, can solve the problems of unclear molecular mechanism, unclear pathogenesis, lack of effective and effective measures, etc., and achieve the effect of high transfection efficiency

Active Publication Date: 2019-05-14
YANTAI YUHUANGDING HOSPITAL
View PDF9 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Since the pathogenesis is still unclear and the molecular mechanism of the disease is unknown, there is still a lack of effective and effective measures for clinical prevention and treatment.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Long non-coding RNA and application of long non-coding RNA in diagnosis of preeclampsia and preparation of target drug for curing preeclampsia
  • Long non-coding RNA and application of long non-coding RNA in diagnosis of preeclampsia and preparation of target drug for curing preeclampsia
  • Long non-coding RNA and application of long non-coding RNA in diagnosis of preeclampsia and preparation of target drug for curing preeclampsia

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0053] Detection of the expression of Linc00284 in placental tissue

[0054]Take 0.1g tissue, grind it sufficiently with liquid nitrogen (into a powder form) or discard the culture medium for 1-5×107 cells, and rinse twice with pre-cooled PBS. Add 1ml of Trizol lysate, pipette and mix with an enzyme-free pipette tip, let stand for 5min, and transfer the lysate into a pre-labeled 1.5ml enzyme-free centrifuge tube. Centrifuge at 7500g at 4°C for 5 minutes, take the supernatant and add 1 / 5 volume of chloroform, invert and mix for 30 seconds, and let stand for 2 minutes. Centrifuge at 12000g for 15min at 4°C. Transfer the aqueous layer to a new 1.5ml centrifuge tube. Add an equal volume of isopropanol, mix gently by inversion, and let stand for 5-10min. Centrifuge at 12000g for 10min at 4°C. Discard the supernatant, add 1ml of 75% ethanol (prepared now), and wash the RNA pellet. Centrifuge at 7500g at 4°C for 5min, discard the supernatant. Try to remove 75% alcohol and dry i...

Embodiment 2

[0069] To study the effect of Linc00284 on the function of HTR-8 / SVneo cells.

[0070] First, the normal trophoblast HTR-8 / SVneo cell line was selected as the research object of this experiment, and lip2000 was used as the transfection reagent carrier to transfect the Linc00284 interference sequence si-Linc00284 1#GAGAAAUAGUCUGUGUUGCCCUGA to effectively knock down the expression of Linc00284, and the MTT assay It was found that knockdown of Linc00284 expression in HTR-8 / SVneo cells promoted cell growth. ( figure 2 A). In addition, overexpression of Linc00284 inhibited the growth of HTR-8 / SVneo cells ( figure 2 B). Thus, these data indicate that Linc00284 can inhibit the proliferation ability of HTR-8 / SVneo cells.

Embodiment 3

[0072] Effect of Linc00284 on trophoblast apoptosis

[0073] Flow cytometry Annexin V / PI double staining method to measure cell apoptosis: In order to study whether Linc00284 affects the proliferation of HTR-8 / SVneo cell cycle transition, the normal trophoblast HTR-8 / SVneo cell line was used as the research object. Using Furgern as a vector, the Linc00284 plasmid was transfected to overexpress the expression of Linc00284.

[0074] 1) Cell collection: Suspension cells are directly collected into a 10ml centrifuge tube, while adherent cells are first blown gently with a dropper. Apoptotic cells may detach after being blown, so they are collected into a 10ml centrifuge tube. Cells that do not detach Digest it with 0.02% EDTA to detach it, and the number of cells per sample is (1~5)×10 6 , 500 ~ 1000r / min centrifuge for 5min to discard the culture medium.

[0075] 2) Wash once with incubation buffer, centrifuge at 500-1000r / min for 5min.

[0076] 3) Resuspend the cells with 100...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a long non-coding RNA and application of the long non-coding RNA in diagnosis of preeclampsia and preparation of a target drug for curing the preeclampsia, belongs to the field of genetic engineering, and particularly relates to application of Linc00284 in diagnosis of preeclampsia and preparation of a target drug for curing the preeclampsia. The up-regulation of the Linc00284 in the placenta of a pregnant woman with the preeclampsia is related to the occurrence and development of the preeclampsia, the Linc00284 with the high expression level is closely related to thepathogenesis of the preeclampsia, the proliferation, apoptosis, invasion, migration and the like of trophoblast cells of the pregnant women with the preeclampsia are affected by changing the expression of the Linc00284, and knock-down of the Linc00284 can promote the invasion and migration abilities of the trophoblast cells.

Description

technical field [0001] The invention belongs to the field of genetic engineering, and particularly relates to the application of long non-coding RNA-Linc00284 in diagnosis and preparation of drugs for treating preeclampsia. Background technique [0002] Preeclampsia (PE) is a pregnancy-specific disease under the combined influence of polygenic genetic background and environmental factors, and the imbalance of immune balance and immune tolerance at the maternal-fetal interface leads to decreased infiltration of placental trophoblast cells, resulting in shallow placental implantation and placental Insufficient blood supply and oxygen supply cause local oxidative stress response, produce a large number of toxic factors and inflammatory mediators, cause vascular endothelial injury and vasospasm in multiple organs throughout the body, and present clinical manifestations of multi-system involvement. It remains one of the leading causes of maternal and perinatal mortality. The onl...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/113C12N15/11C12Q1/6883A61K31/7088A61P15/00
Inventor 邹艳芬李淑红许叶涛余翔
Owner YANTAI YUHUANGDING HOSPITAL
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More