Unlock instant, AI-driven research and patent intelligence for your innovation.

Mycobacterium tuberculosis drug resistance detection method

A Mycobacterium tuberculosis and detection method technology, which is applied in the field of drug resistance detection of Mycobacterium tuberculosis, can solve the problems of inconspicuous effect, decolorization error, increased detection time and cost, etc., and achieve the goal of shortening protein expression time and rapid detection Effect

Pending Publication Date: 2019-05-24
ANHUI UNIV OF SCI & TECH
View PDF4 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

In the rabbit reticulocyte expression system, the solution is dark red, which is close to the color of the reaction product measured by pyrazinamidase activity. The solution needs to be decolorized, which increases the detection time and cost, and incomplete decolorization will also bring new problems. error
In this report, the wheat germ expression system was also used, but the effect was not obvious, and the detection sensitivity was many times worse than that of rabbit reticulocytes
In addition, the PCR primers used in this report partially overlap with the pncA gene sequence, and the PCR primers cover part of the pncA gene mutation site, resulting in the need to use at least two pairs of primers to be resistant to a Mycobacterium tuberculosis pyrazinamide complete detection of sex, increasing the complexity and cost of detection

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Mycobacterium tuberculosis drug resistance detection method
  • Mycobacterium tuberculosis drug resistance detection method
  • Mycobacterium tuberculosis drug resistance detection method

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0041] PCR Amplification of Full-length Mycobacterium tuberculosis Pyrazinamidase Gene Primers Containing T7 Promoter-Wheat Germ Cell-Free In Vitro Protein Expression Determination of Pyrazinamide in Tuberculosis Pyrazinamide-Susceptible Strains (H37RA) and Pyrazinamide-Resistant Strains (BCG) drug resistance.

[0042] 1. Liquid nitrogen low-temperature grinding to lyse Mycobacterium tuberculosis to quickly prepare a template for PCR reaction: take 1ml of tuberculosis liquid, 4000rpm, centrifuge for 1min, remove the supernatant, collect the bacteria, add 500ul liquid nitrogen low-temperature grinding for 5min, then 6000rpm , centrifuged for 3 min, and carefully aspirate the supernatant as a template for amplifying the pyrazinamidase gene (pncA).

[0043] 2. Design of primers for PCR amplification of pncA gene.

[0044] Upstream primer sequence P1: 5'-TAATACGACTCACTATAGGCCCGCCCGAACG-3',

[0045] Downstream primer sequence: 5'-GCCGCCAACAGTTC-3'.

[0046] PCR amplification con...

Embodiment 2

[0063] PCR amplification of full-length pyrazinamide gene primers containing T7 promoter and enhancer-wheat germ cell-free in vitro protein expression assay of tuberculosis pyrazinamide-sensitive (H37RA) and pyrazinamide-resistant strains (BCG) Pyrazinamide resistance.

[0064] 1. Liquid nitrogen low-temperature grinding to lyse Mycobacterium tuberculosis to quickly prepare a template for PCR reaction: take 1ml of tuberculosis liquid, 4000rpm, centrifuge for 1min, remove the supernatant, collect the bacteria, add 500ul liquid nitrogen low-temperature grinding for 5min, then 6000rpm , centrifuged for 3 min, and carefully aspirate the supernatant as a template for amplifying the pyrazinamidase gene (pncA).

[0065] 2. The fragment of pncA gene was amplified by PCR.

[0066] Upstream primer sequence P2:

[0067] 5'-TAATACGACTCACTATAGGTATTTTTACAACAATTACCAACAACAACAAACAACAAACAATTACAATTACTATTTACAATTACACCCGAACGTAAGGAGGACGT-3',

[0068] or

[0069] 5'-TAATACGACTCACTATAGGATACTCCCCCA...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the technical field of biological techniques, and particularly relates to a mycobacterium tuberculosis drug resistance detection method which includes the steps: splitting a template of mycobacterium tuberculosis for PCR (polymerase chain reaction); designing PCR primers and amplifying full-length pyrazinamide enzyme (pncA) genes; concentrating and quantifying the amplified pncA gene segments; expressing pncA enzyme by a wheat germ cell-free expression system; measuring the activity of the expressed pncA enzyme for transforming pyrazinamide into pyrazinoic acid, comparing the activity with pncA enzyme activity of similarly expressed mycobacterium tuberculosis standard sensitive strains and drug resistance strains and measuring the drug resistance of mycobacterium tuberculosis pyrazinamide enzyme. The drug resistance caused by pncA gene mutation can be measured by one pair of primers. Besides, the invention further discloses a primer sequence which can amplify the full-length pncA genes from a mycobacterium tuberculosis genome and is suitable for pyrazinamide enzyme expression by the wheat germ cell-free expression system. The drug resistance of the mycobacterium tuberculosis pyrazinamide is rapidly and sensitively detected, and bacterial culture is omitted.

Description

technical field [0001] The invention belongs to the technical field of biotechnology, in particular to a method for detecting drug resistance of Mycobacterium tuberculosis. Background technique [0002] Tuberculosis is one of the most threatening infectious diseases to humans. Although Mycobacterium bovis vaccine (BCG) and various anti-tuberculosis drugs have been widely used around the world, in recent years, with the increase of population flow and population density, Increased, multidrug-resistant strains of Mycobacterium tuberculosis and double infection with human immunodeficiency virus (HIV), tuberculosis has been raging again in developed and developing countries. According to reports, in 2005, there were about 8.8 million new tuberculosis patients in the world, and about 1.6 million people died of tuberculosis every year. Due to the long history of tuberculosis, the drug resistance of tuberculosis is very serious, and the emergence of multi-drug-resistant and super-...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/44G01N21/31
Inventor 王晓春邢应如石连
Owner ANHUI UNIV OF SCI & TECH