Mycobacterium tuberculosis drug resistance detection method
A Mycobacterium tuberculosis and detection method technology, which is applied in the field of drug resistance detection of Mycobacterium tuberculosis, can solve the problems of inconspicuous effect, decolorization error, increased detection time and cost, etc., and achieve the goal of shortening protein expression time and rapid detection Effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0041] PCR Amplification of Full-length Mycobacterium tuberculosis Pyrazinamidase Gene Primers Containing T7 Promoter-Wheat Germ Cell-Free In Vitro Protein Expression Determination of Pyrazinamide in Tuberculosis Pyrazinamide-Susceptible Strains (H37RA) and Pyrazinamide-Resistant Strains (BCG) drug resistance.
[0042] 1. Liquid nitrogen low-temperature grinding to lyse Mycobacterium tuberculosis to quickly prepare a template for PCR reaction: take 1ml of tuberculosis liquid, 4000rpm, centrifuge for 1min, remove the supernatant, collect the bacteria, add 500ul liquid nitrogen low-temperature grinding for 5min, then 6000rpm , centrifuged for 3 min, and carefully aspirate the supernatant as a template for amplifying the pyrazinamidase gene (pncA).
[0043] 2. Design of primers for PCR amplification of pncA gene.
[0044] Upstream primer sequence P1: 5'-TAATACGACTCACTATAGGCCCGCCCGAACG-3',
[0045] Downstream primer sequence: 5'-GCCGCCAACAGTTC-3'.
[0046] PCR amplification con...
Embodiment 2
[0063] PCR amplification of full-length pyrazinamide gene primers containing T7 promoter and enhancer-wheat germ cell-free in vitro protein expression assay of tuberculosis pyrazinamide-sensitive (H37RA) and pyrazinamide-resistant strains (BCG) Pyrazinamide resistance.
[0064] 1. Liquid nitrogen low-temperature grinding to lyse Mycobacterium tuberculosis to quickly prepare a template for PCR reaction: take 1ml of tuberculosis liquid, 4000rpm, centrifuge for 1min, remove the supernatant, collect the bacteria, add 500ul liquid nitrogen low-temperature grinding for 5min, then 6000rpm , centrifuged for 3 min, and carefully aspirate the supernatant as a template for amplifying the pyrazinamidase gene (pncA).
[0065] 2. The fragment of pncA gene was amplified by PCR.
[0066] Upstream primer sequence P2:
[0067] 5'-TAATACGACTCACTATAGGTATTTTTACAACAATTACCAACAACAACAAACAACAAACAATTACAATTACTATTTACAATTACACCCGAACGTAAGGAGGACGT-3',
[0068] or
[0069] 5'-TAATACGACTCACTATAGGATACTCCCCCA...
PUM
![No PUM](https://static-eureka.patsnap.com/ssr/23.2.0/_nuxt/noPUMSmall.5c5f49c7.png)
Abstract
Description
Claims
Application Information
![application no application](https://static-eureka.patsnap.com/ssr/23.2.0/_nuxt/application.06fe782c.png)
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com