Unlock instant, AI-driven research and patent intelligence for your innovation.

A kind of Bacillus subtilis and its application in the production of alginate lyase

A technology of Bacillus subtilis and alginate lyase, applied in the field of genetic engineering, can solve problems such as high cost, difficulty in meeting practical application requirements, and low output, and achieve the effects of increasing output, maintaining stable levels, and reducing production costs

Active Publication Date: 2021-12-28
QINGDAO VLAND BIOTECH GRP +1
View PDF10 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Although wild-type alginate-decomposing bacteria can effectively obtain quantitative enzyme protein, the yield is very low and the cost is high, which is difficult to meet the requirements of practical application

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0046] The construction of embodiment 1 Bacillus subtilis expression vector

[0047] 1.1 Gene cloning

[0048] According to the public report of NCBI, the alginate lyase gene was artificially synthesized and optimized according to the codon preference of Bacillus subtilis. Using the synthesized gene as a template, PCR amplification was performed using the following primers:

[0049] Primer szx302-F: ggcgttcagcaacatgagcgcgcaggctcaggataaaaaatctaaatct;

[0050] Primer szx302-R: ccgtcctctgttaacctcgagttattattaatgcgtcacctgaagacta;

[0051] The PCR amplification conditions were 95°C for 4min; 30 cycles of 94°C for 30S, 59°C for 40S, and 72°C for 1min; and 72°C for 7min. The PCR amplification products were recovered using a gel extraction kit.

[0052] 1.2 Sequencing analysis

[0053] The amplified product recovered in 1.1 was connected to the pSZX302 plasmid to obtain the recombinant plasmid ALY-pSZX302, and sent to Beijing Huada Gene Research Center for sequencing analysis. Se...

Embodiment 2

[0054] Embodiment 2 transformation and screening

[0055] 2.1 Conversion

[0056] The recombinant plasmid ALY-pSZX302 with correct sequencing was transformed into the host bacterium Bacillus subtilis F4 (Bacillus subtilis F4), and the Bacillus subtilis strain expressing alginate lyase AL was obtained, and it was named as Bacillus subtilis F4-szx302 (Bacillus subtilis F4). F4-szx302).

[0057] The specific transformation process is as follows: freshly activated Bacillus subtilis F4 was inoculated into 5ml of GMI solution from LB plates, cultured with shaking at 30°C and 125rpm overnight to obtain culture solution A; 2ml of culture solution A was transferred to 18ml of GMI solution for 37 Cultivate at 250rpm for 3.5 hours to obtain culture solution B; take 10ml of culture solution B and transfer it to 90ml of GMⅡ solution, and culture at 37℃ and 125rpm for 90min to obtain culture solution C; centrifuge at 5000g and 10min to collect the bacteria in culture solution C , use 10ml...

Embodiment 3

[0070] Example 3 Enzymatic property analysis of alginate lyase produced by Bacillus subtilis ALY-38

[0071] 3.1 Optimum pH analysis

[0072] Dilute the fermentation supernatant of Bacillus subtilis ALY-38 with pH values ​​of 4.5, 5.0, 5.5, 6.0, 6.5, 7.0, 7.5, and 8.0 respectively, and measure the enzyme activity of the fermentation supernatant at 40°C to determine The highest enzyme activity is 100%. The relative enzyme activity is calculated and the pH-relative enzyme activity curve is made. Meanwhile, the fermentation supernatant of the starting bacterium Bacillus subtilis F4-szx302-G is used as the control group. The results show that the optimum pH value of the alginate lyase produced by the mutant strain Bacillus subtilis ALY-38 obtained in the present invention is 6.5, which is consistent with the optimum pH value of the alginate lyase produced by the original strain.

[0073] 3.2 Optimum temperature analysis

[0074] Determination of enzymes in the fermentation super...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to the technical field of genetic engineering, in particular to a mutant strain of bacillus subtilis and its application in the production of alginate lyase. The mutant strain is screened by ultraviolet mutagenesis method, which can significantly increase the yield of alginate lyase, and the enzyme activity of shake flask fermentation can reach 1500U / ml, which is 30.4% higher than that of the original strain; the fermentation activity of 20L tank is as high as 3600U / ml, which is 32% higher than the starting bacteria. The mutant strain will help reduce the production cost of alginate lyase, and has broad market prospect.

Description

technical field [0001] The invention relates to the technical field of genetic engineering, in particular to a mutant strain of bacillus subtilis and its application in the production of alginate lyase. Background technique [0002] Alginic acid is a marine polysaccharide whose reserves are second only to cellulose. Alginic acid exists in the cell wall and intercellular matrix of seaweed, and is most abundant in brown algae, and most of the giant brown algae are potential sources of alginic acid. However, different types of brown algae contain different properties of alginic acid, so the source of brown algae should be selected according to the availability of brown algae and the properties of alginic acid. The main commercial sources of alginic acid are Ascophyllum nodosum, bullweed, wingweed, kelp, kelp, sargassum and trumpetweed, the most important of which are kelp, kelp and ascophyllum. The global production of alginic acid is mainly distributed in coastal countries a...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N1/21C12N9/88C12N15/60C12R1/125
CPCC12N9/88
Inventor 许丽红石增秀周利伟黄亦钧
Owner QINGDAO VLAND BIOTECH GRP