A kind of Bacillus subtilis and its application in the production of alginate lyase
A technology of Bacillus subtilis and alginate lyase, applied in the field of genetic engineering, can solve problems such as high cost, difficulty in meeting practical application requirements, and low output, and achieve the effects of increasing output, maintaining stable levels, and reducing production costs
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Examples
Embodiment 1
[0046] The construction of embodiment 1 Bacillus subtilis expression vector
[0048] According to the public report of NCBI, the alginate lyase gene was artificially synthesized and optimized according to the codon preference of Bacillus subtilis. Using the synthesized gene as a template, PCR amplification was performed using the following primers:
[0049] Primer szx302-F: ggcgttcagcaacatgagcgcgcaggctcaggataaaaaatctaaatct;
[0050] Primer szx302-R: ccgtcctctgttaacctcgagttattattaatgcgtcacctgaagacta;
[0051] The PCR amplification conditions were 95°C for 4min; 30 cycles of 94°C for 30S, 59°C for 40S, and 72°C for 1min; and 72°C for 7min. The PCR amplification products were recovered using a gel extraction kit.
[0052] 1.2 Sequencing analysis
[0053] The amplified product recovered in 1.1 was connected to the pSZX302 plasmid to obtain the recombinant plasmid ALY-pSZX302, and sent to Beijing Huada Gene Research Center for sequencing analysis. Se...
Embodiment 2
[0054] Embodiment 2 transformation and screening
[0055] 2.1 Conversion
[0056] The recombinant plasmid ALY-pSZX302 with correct sequencing was transformed into the host bacterium Bacillus subtilis F4 (Bacillus subtilis F4), and the Bacillus subtilis strain expressing alginate lyase AL was obtained, and it was named as Bacillus subtilis F4-szx302 (Bacillus subtilis F4). F4-szx302).
[0057] The specific transformation process is as follows: freshly activated Bacillus subtilis F4 was inoculated into 5ml of GMI solution from LB plates, cultured with shaking at 30°C and 125rpm overnight to obtain culture solution A; 2ml of culture solution A was transferred to 18ml of GMI solution for 37 Cultivate at 250rpm for 3.5 hours to obtain culture solution B; take 10ml of culture solution B and transfer it to 90ml of GMⅡ solution, and culture at 37℃ and 125rpm for 90min to obtain culture solution C; centrifuge at 5000g and 10min to collect the bacteria in culture solution C , use 10ml...
Embodiment 3
[0070] Example 3 Enzymatic property analysis of alginate lyase produced by Bacillus subtilis ALY-38
[0071] 3.1 Optimum pH analysis
[0072] Dilute the fermentation supernatant of Bacillus subtilis ALY-38 with pH values of 4.5, 5.0, 5.5, 6.0, 6.5, 7.0, 7.5, and 8.0 respectively, and measure the enzyme activity of the fermentation supernatant at 40°C to determine The highest enzyme activity is 100%. The relative enzyme activity is calculated and the pH-relative enzyme activity curve is made. Meanwhile, the fermentation supernatant of the starting bacterium Bacillus subtilis F4-szx302-G is used as the control group. The results show that the optimum pH value of the alginate lyase produced by the mutant strain Bacillus subtilis ALY-38 obtained in the present invention is 6.5, which is consistent with the optimum pH value of the alginate lyase produced by the original strain.
[0073] 3.2 Optimum temperature analysis
[0074] Determination of enzymes in the fermentation super...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More