Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Method and kit for detecting copy number of CAR by dual fluorescence quantitative PCR

A kit, copy number technology, applied in the biological field

Inactive Publication Date: 2019-07-05
SHANGHAI CELL THERAPY RES INST +1
View PDF2 Cites 7 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Amplification of two genes in the same tube, often causing competitive inhibition

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method and kit for detecting copy number of CAR by dual fluorescence quantitative PCR
  • Method and kit for detecting copy number of CAR by dual fluorescence quantitative PCR
  • Method and kit for detecting copy number of CAR by dual fluorescence quantitative PCR

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0105] Example 1: Design and synthesis of primers and probes

[0106] Based on the CD28-CD3zeta signal region ( figure 1 ) and CD137-CD3zeta signal region ( figure 2 ) and the internal reference gene Actin to design primers and probes, and entrust Shanghai Jierui Biotechnology Co., Ltd. to synthesize them. The sequences of the primers and probes are shown in Table 1 below. Among them, CD28-CD3zeta and CD137-CD3zeta probes introduce locked nucleic acid monomers, and bases with uppercase letters are bases modified by locked nucleic acids.

[0107] Table 1: Primer sequences and probe sequences

[0108]

[0109]

[0110] CD28-CD3zeta signal domain sequence:

[0111] CCCTTTTGGGTGCTGGTGGTGGTTGGTGGAGTCCTGGCTTGCTATAGCTTGCTAGTAACAGTGGCCTTTATTATTTTCTGGGTGAGGAGTAAGAGGAGCAGG CTCCTGCACAGTGACTACATGAACATGACTCCCCGCCGCCCCGGGCCCACCC GCAAGCATTACCAGCCCTATGCCCCACCACGCGACTTCGCAGCCTATCGCTCCAGAGTGAAGTTC AGCAGGAGCGCAGACGCCCCCGCGTACCAGCAGGGCCAGAACCAGCTCTATAACGAGCTCAATCTAGGACGAAGAGAGGA...

Embodiment 2

[0116] Example 2: Using double fluorescent quantitative PCR to detect the region containing CD28-CD3zeta and CD137-CD3zeta region CAR plasmid transduction samples for transduction efficiency evaluation

[0117] 1. Samples, reagents and instruments

[0118] Samples: 36 T cell samples electroporated with CAR plasmid containing CD28-CD3zeta region, 36 T cell samples electroporated with CAR plasmid containing CD137-CD3zeta region. Untransfected T cells were selected as control samples.

[0119] Reagents: Cell Genomic DNA Extraction Kit (Tiangen Biochemical Company), TaqMan gene expressionMaster Mix Reagent (ABI Company).

[0120] Instrument: LightCycler480 fluorescent quantitative PCR detector (Roche).

[0121] 2. Experimental method

[0122] Genomes were extracted from 36 samples of T cell electrotransfected with CAR plasmid containing CD28-CD3zeta gene and 36 samples of T cell electrotransferred with CAR plasmid containing CD137-CD3zeta gene. Prepare the reaction solutio...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the technical field of biology, and relates to a method and kit for detecting the copy number of CAR by dual fluorescence quantitative PCR. The primer pair for the method is selected from an arbitrary 1, 2 or 3 of the following 3 primer pairs: primer pair 1 which is a primer pair as shown in SEQ ID NO:1 and SEQ ID NO:2, a primer pair 2 which is a primer pair as shown in SEQ ID NO:4 and SEQ ID NO:5, and a primer pair 3 which is a primer pair as shown in SEQ ID NO:7 and SEQ ID NO:8. The method provides accurate technical support to quality control and curative effect monitor on CAR-T immunocyte treatment. The detection method can provide accuracy and sensitivity close to detection of single fluorescence quantitative PCR method, but dosage and operation for the methodis double saved, the experimental error caused by detection cost and operation can be remarkably reduced, and the detection efficiency and detection accuracy can be improved.

Description

technical field [0001] The invention belongs to the field of biotechnology, and relates to a method and a kit for measuring the copy number of CAR by double fluorescence quantitative PCR. Specifically, the present invention relates to a method for determining the copy number of a second-generation CAR or a third-generation CAR containing a CD28-CD3zeta signal region and a CD137-CD3zeta signal region by double fluorescent quantitative PCR. Background technique [0002] Chimeric Antigen Receptor T-Cell (CAR-T) immunotherapy is currently one of the most promising methods for curing tumors in tumor immunotherapy, and it has shown very positive effects in the treatment of hematological malignancies The effective rate for advanced relapsed and refractory B-cell acute lymphoblastic leukemia can reach 90%, and the effective rate for chronic lymphocytic leukemia and some B-cell lymphomas is >50%. On August 30, 2017, the US FDA approved Novartis' CAR-T therapy Kymriah (formerly kn...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/6851C12Q1/02C12N15/11C12Q1/6876
CPCC12Q1/6851C12Q1/6876C12Q2531/113C12Q2537/143C12Q2563/107C12N15/11C12Q1/02C12Q1/06C12Q1/68
Inventor 钱其军金华君郝方元王超孙娟娟
Owner SHANGHAI CELL THERAPY RES INST
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com