Method and kit for detecting copy number of CAR by dual fluorescence quantitative PCR
A kit, copy number technology, applied in the biological field
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0105] Example 1: Design and synthesis of primers and probes
[0106] Based on the CD28-CD3zeta signal region ( figure 1 ) and CD137-CD3zeta signal region ( figure 2 ) and the internal reference gene Actin to design primers and probes, and entrust Shanghai Jierui Biotechnology Co., Ltd. to synthesize them. The sequences of the primers and probes are shown in Table 1 below. Among them, CD28-CD3zeta and CD137-CD3zeta probes introduce locked nucleic acid monomers, and bases with uppercase letters are bases modified by locked nucleic acids.
[0107] Table 1: Primer sequences and probe sequences
[0108]
[0109]
[0110] CD28-CD3zeta signal domain sequence:
[0111] CCCTTTTGGGTGCTGGTGGTGGTTGGTGGAGTCCTGGCTTGCTATAGCTTGCTAGTAACAGTGGCCTTTATTATTTTCTGGGTGAGGAGTAAGAGGAGCAGG CTCCTGCACAGTGACTACATGAACATGACTCCCCGCCGCCCCGGGCCCACCC GCAAGCATTACCAGCCCTATGCCCCACCACGCGACTTCGCAGCCTATCGCTCCAGAGTGAAGTTC AGCAGGAGCGCAGACGCCCCCGCGTACCAGCAGGGCCAGAACCAGCTCTATAACGAGCTCAATCTAGGACGAAGAGAGGA...
Embodiment 2
[0116] Example 2: Using double fluorescent quantitative PCR to detect the region containing CD28-CD3zeta and CD137-CD3zeta region CAR plasmid transduction samples for transduction efficiency evaluation
[0117] 1. Samples, reagents and instruments
[0118] Samples: 36 T cell samples electroporated with CAR plasmid containing CD28-CD3zeta region, 36 T cell samples electroporated with CAR plasmid containing CD137-CD3zeta region. Untransfected T cells were selected as control samples.
[0119] Reagents: Cell Genomic DNA Extraction Kit (Tiangen Biochemical Company), TaqMan gene expressionMaster Mix Reagent (ABI Company).
[0120] Instrument: LightCycler480 fluorescent quantitative PCR detector (Roche).
[0121] 2. Experimental method
[0122] Genomes were extracted from 36 samples of T cell electrotransfected with CAR plasmid containing CD28-CD3zeta gene and 36 samples of T cell electrotransferred with CAR plasmid containing CD137-CD3zeta gene. Prepare the reaction solutio...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap