Efficiently recombinant vaccinia virus vector without screening markers and establishment method of vaccinia virus vector

A technology for vaccinia virus vectors and recombinant virus vectors, applied in the field of highly efficient recombination and non-screening vaccinia virus vectors and its establishment, can solve problems, generate safety and other issues, and achieve increased possibilities, time savings, and improved recombination efficiency effect

Inactive Publication Date: 2019-07-19
INST OF PATHOGEN BIOLOGY CHINESE ACADEMY OF MEDICAL SCI
View PDF4 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Using the screening marker gene, positive recombinant clones can be screened out from a large number of negative clones, but with the passaging of the recombinant virus, the screening marker gene is no longer useful, but it has been continuously expressed for a long time, causing safety problems

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Efficiently recombinant vaccinia virus vector without screening markers and establishment method of vaccinia virus vector
  • Efficiently recombinant vaccinia virus vector without screening markers and establishment method of vaccinia virus vector
  • Efficiently recombinant vaccinia virus vector without screening markers and establishment method of vaccinia virus vector

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0054] Example 1 Obtaining recombinant virus by CRISPR-Cas9 system

[0055] 1. Method

[0056] 1.1. Design of gRNA

[0057] For the Tiantan strain vaccinia virus TK region, design gRNA sequences through the website (http: / / crispr.mit.edu / , http: / / www.e-crisp.org / E-CRISP / ), including gRNA1, gRNA2 and gRNA3 ( Such as figure 1 shown).

[0058] The sequence of gRNA1 is: GAAACCGAGATAGAAATAAT;

[0059] The sequence of gRNA2 is: GTTATAGTAGCCGCACTCGA;

[0060] The sequence of gRNA3 is: GTGAGCGTATGGCAAACGA.

[0061] 1.2. Detection of expression and localization of Cas9 protein in gRNA-Cas9 plasmid

[0062] 1.2.1, protein extraction

[0063] At 293T (5×10 5 ) cells were transfected with Lenti-delNLS, Lenti-delNLS-gRNA1, Lenti-delNLS-gRNA2, Lenti-delNLS-gRNA3, and the cells were harvested after 48 hours. Centrifuge at 3000rpm for 3min, wash once with PBS, add 100μL of cell lysate RIPA, and store at -20°C for later use.

[0064] 1.2.2, Western Blot detection of Cas9 expression ...

Embodiment 2

[0116] Example 2 Delete the screening marker EGFP in the recombinant virus by Cre-LoxP technology

[0117] 1. Method

[0118] 1.1 Construction and identification of pQCXIP-Cre plasmid

[0119] The Cre was constructed into the pQCXIP vector by molecular cloning, and the sequence was confirmed to be correct by sequencing.

[0120] 1.2. Acquisition of recombinant virus VACV-ΔTK

[0121] 1.2.1. Delete EGFP in VACV-ΔTK-EGFP-LoxP virus by transfecting pQCXIP-Cre plasmid

[0122] 293T cells (5×10 5 ) were inoculated in a six-well plate in complete antibiotic-free DMEM medium, cultured overnight, and when the cell growth was 60% to 70%, the control and pQCXIP-Cre plasmids were transfected, and the medium was replaced with 10% FBS after 4 to 6 hours. After 24h, the recombinant virus was diluted with DMEM

[0123] VACV-ΔTK-EGFP-LoxP was used to infect the cells; after 2 hours, the culture medium was replaced with 2% FBS; after 48 hours, 1.2 mL of the supernatant was discarded, the ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

PropertyMeasurementUnit
thicknessaaaaaaaaaa
Login to view more

Abstract

The invention discloses an efficiently recombinant vaccinia virus vector without screening markers and an establishment method of the vaccinia virus vector. The TK region of vaccinia virus Tiantan strain is knocked out by CRISPR-Cas9 technology and then the processed vaccinia virus Tiantan strain is transfected with a recombinant plasmid pJ2R-EGFP-LoxP with EGFP. By fluorescent screening, a recombinant virus lacking TK and with inserted EGFP is obtained. Through calculation, the efficiency of the recombination is dozens of times higher than that of conventional homologous recombination, and anefficiently recombinant vaccinia virus vector system is established. Based on the recombinant viral vector, a screening marker, EGFP, in the recombinant viral vector is eliminated by a Cre-LoxP system. Through molecular cloning technology, a Western Blot experiment, immunofluorescence, PCR technology, etc., EGFP is accurately eliminated at a specific site of the resulting recombinant virus. The invention establishes the efficiently recombinant vaccinia virus vector system, the screening marker of the vaccinia virus vector is eliminated, and therefore the application value to vaccine vector construction, tumor immunotherapy and other aspects is improved.

Description

technical field [0001] The invention relates to the technical field of gene recombination, in particular to a high-efficiency recombination and no selection marker-free vaccinia virus vector and its establishment method. Background technique [0002] Poxviruses are a class of enveloped, linear double-stranded DNA viruses with large genomes, including Vaccinia virus, Variola virus, Cowpox virus and Monkeypox virus. poxvirus) and so on. It has the characteristics of many non-essential genes, large capacity of foreign genes (<25kbp) and cytoplasmic replication, so vaccinia virus and other types of poxviruses can be used in the form of vectors to resist human immunodeficiency virus (Human immunodeficiency virus, HIV ), influenza virus (Influenza virus) and other vaccines; more importantly, by knocking out specific genes of vaccinia virus, it can be tumor-selective, and can be used as a carrier of oncolytic virus to become a new means of tumor immunotherapy . [0003] The m...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/863C12N7/01C12N15/113C12N15/90
CPCC12N15/86C12N7/00C12N15/113C12N15/902C12N9/1211C12Y207/01021C12N2710/24043C12N2710/24021C12N2501/10C12N2501/20C12N2310/10C12N2310/20
Inventor 郭斐许丰雯张迪
Owner INST OF PATHOGEN BIOLOGY CHINESE ACADEMY OF MEDICAL SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap