Method for producing l-lysine by bacterial fermentation with altered ppc promoter

A lysine and promoter technology, applied in the field of amino acid fermentation, can solve the problems of unpredictable impact on L-lysine production, and achieve the effect of facilitating popularization and application and increasing production

Active Publication Date: 2020-08-04
HEILONGJIANG EPPEN BIOTECH CO LTD
View PDF8 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0003] reported in existing literature ppc (phosphoenolpyruvate carboxylase, phosphoenolpyruvatecarboxylase) gene, its regulatory elements and the increase, decrease or mutation of its encoded protein are used in the production of amino acids (including L-lysine), for example, WO0100844A2, WO2005058945A2, EP0358940A1 and JP1998165180A etc., yet, the property of the regulatory element after mutation is unpredictable, and correspondingly, its influence on L-lysine production is also unpredictable, especially, in recent more than ten years, to ppc New studies of the effects of mutations in genes and their regulatory elements on L-lysine production have been scarce, suggesting that researchers are unsure whether new ppc There has been less and less interest in mutations of genes and their regulatory elements to improve L-lysine production

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for producing l-lysine by bacterial fermentation with altered ppc promoter
  • Method for producing l-lysine by bacterial fermentation with altered ppc promoter

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0037] Example 1 contains point deletion NCgl1523 Construction of gene promoter transformation vector pK18-NCgl1523

[0038] According to the genome sequence of Corynebacterium glutamicum ATCC13032 published by NCBI, two pairs of amplification were synthesized NCgl1523 Gene promoter region fragment (the nucleotide sequence including the promoter and coding region is shown as the complementary sequence of SEQ ID NO: 5, or it can be accessed at https: / / www.ncbi.nlm.nih.gov / gene / *term =NCgl1523) primers to replace the wild type on the chromosome of strain YPL-4 by allelic replacement NCgl1523 One base is knocked out at position -1 of the promoter region of the gene (the nucleotide sequence including the promoter and the coding region is shown as the complementary sequence of SEQ ID NO: 6). Primers were designed as follows (synthesized by Shanghai Invitrogen Company):

[0039] P1': 5' CCGGAATTC GTGATGCGACGGCGGATGT 3' (EcoR I)

[0040] P2': 5' CTCAATGTGAAAGAGTGTTTAAAGTAGTTAA...

Embodiment 2

[0044] Example 2 contains point deletion NCgl1523 Construction of strains with gene promoters

[0045] The plasmid pK18-NCgl1523 obtained in Example 1 was electrotransformed into the lysine producing bacterium (Corynebacterium glutamicum) patent strain YPL-4 (namely YP97136) (for its construction method, please refer to WO2014121669A1; it was confirmed by sequencing that the strain on the chromosome wild-type NCgl1523 Genes and their promoters), the single colonies produced by culture were identified by primers P1' / M13F, and the strains that could amplify a band with a size of 1100bp were positive strains. The positive strains were cultured on a medium containing 12% sucrose, and the single colony produced by the culture was cultured on a medium containing kanamycin and a medium without kanamycin, respectively, and cultured on a medium without kanamycin The strains that grow on culture medium but do not grow on medium containing kanamycin are further identified by PCR usin...

Embodiment 3

[0049] Example 3 Contains point mutations NCgl1523 Gene transformation vector pK18-NCgl1523 A482V build

[0050] According to the genome sequence of Corynebacterium glutamicum ATCC13032 published by NCBI, two pairs of amplification were synthesized NCgl1523 Primers for fragments of the gene coding region (its nucleotide sequence is shown in the complementary sequence of SEQ ID NO: 1, and the encoded amino acid sequence is shown in SEQ ID NO: 3), so as to replace the YPL-4 chromosome by alleles wild type on NCgl1523 A482V point mutation is introduced into the coding region of the gene (the nucleotide sequence is shown in the complementary sequence of SEQ ID NO: 2, and the encoded amino acid sequence is shown in SEQ ID NO: 4). Primers were designed as follows (synthesized by Shanghai Invitrogen Company):

[0051] P1: 5' CGC GGATCC CCTGGGCTGGGCAAGAATC 3' (BamH I)

[0052] P2: 5' CCGAATTTCTTAACAACCTCCGACGCGGTG 3'

[0053] P3: 5' CACCGCGTCGGAGGTTGTTA AGAAATTCGG 3'

[00...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention provides a method for producing L-lysine through fermentation. The method comprises the steps of transforming a promoter region of a wild-type ppc gene on a corynebacterium glutamicum chromosome and using corynebacterium glutamicum obtained through transformation to produce the L-lysine through fermentation. In addition, the invention further provides methods and application derivedfrom the method, as well as corynebacterium glutamicum, polynucleotides and the like which can be applied to the methods and application.

Description

technical field [0001] The present invention belongs to the field of amino acid fermentation, and in particular, the present invention relates to a method for producing L-lysine by fermentation, a method and application of its derivation, and bacteria that can be used in these methods and applications. Background technique [0002] Production of L-lysine by fermentation of L-lysine-producing bacteria (eg, Escherichia coli of the genus Escherichia and rod-shaped bacteria of the genus Corynebacterium) has been industrially applied. These bacteria can be bacteria isolated from nature, bacteria obtained through mutagenesis or genetic engineering, or both. [0003] reported in existing literature ppc (phosphoenolpyruvate carboxylase, phosphoenolpyruvatecarboxylase) gene, its regulatory elements and the increase, decrease or mutation of its encoded protein are used in the production of amino acids (including L-lysine), for example, WO0100844A2, WO2005058945A2, EP0358940A1 and JP...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Patents(China)
IPC IPC(8): C12P13/08C12N1/21C12R1/15
CPCC12N9/88C12P13/08C12Y401/01031
Inventor 孟刚周晓群魏爱英苏厚波马风勇赵春光
Owner HEILONGJIANG EPPEN BIOTECH CO LTD
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap