A molecular marker, detection method and application related to pig muscle fiber area and intramuscular fat content
A technology of molecular markers and intramuscular fat, which is applied in biochemical equipment and methods, microbiological determination/inspection, DNA/RNA fragments, etc., can solve the problems of slow progress in candidate gene research, and achieve convenient and easy-to-operate detection methods, low cost effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0032] Example 1 Nucleotide sequence cloning and SNP scanning of the first exon to the third exon region of TNNC2 gene
[0033] 1. Primer Design
[0034] Download the TNNC2 gene sequence of pig (Sscrofa11.1) from the ensembl database, GenBank accession number: NC_010445.4, wherein the DNA sequence from the first exon to the third exon region is as follows, and see SEQ ID NO: 1; Sequence Listing In the figure, the horizontal line indicates the sequence information of the PCR products amplified by subsequent experiments, the sequence in the box line is the sequence of the splice donor mutation detected in the subsequent experiment, and the arrow represents the insertion site of the insertion mutation detected in the subsequent experiment.
[0035]GACACGCAACCATGGTAAGGACGAGAGGGGATTTCATCCCTTTACTCGCCGGAGCACTTCTGGGCCAGATCCGGGTGCTCTGCAGGGCAGTAACTTGGATGTCTGAAGATGGACCCAGGCGTCTGGGAGGAAGCCCCAGAAGAAGGCCTTGGACTTGTCTTGGAAGGGGAGGGCTGGGACGTTCCAGGGCTTGACTCTCAAGGCATGCCTGTTCCCTGAGATCTTCGGAGGATTCC...
Embodiment 2
[0053] The detection method of embodiment 2 TNNC2 gene INDEL mutation
[0054] S1: Primer design. Specific primers were designed for the INDEL mutation present at the first exon of the TNNC2 gene as follows:
[0055]TNNC2_M1_F: 5'CCTATCGCCACCTTACTGTCAC 3', see SEQ ID NO:6;
[0056] TNNC2_M1_R: 5'CAGCTGAAGAATAATGCAATGC 3', see SEQ ID NO:7.
[0057] S2: PCR amplification, the total PCR reaction system is 10 μL, including 1 μL of porcine genomic DNA at a concentration of 50 ng / μL; 5 μL of 2×Taq PCR Mix; 0.2 μL of 10 mM forward and reverse specific primers; 3.6 μL The amplification conditions were: pre-denaturation at 95°C for 3 min; denaturation at 95°C for 30 s; annealing at 60°C for 30 s; extension at 72°C for 15 s; 35 cycles; stop extension at 72°C for 5 min; cooling at 15°C for 2 min. Among them, 2×Taq PCR Mix was purchased from Beijing Aidelai Biotechnology Co., Ltd. PCR products were detected by 1% agarose gel electrophoresis. Using primers TNNC2_M1_F and TNNC2_M1_R to...
Embodiment 3
[0061] Example 3 Detection of Genetic Diversity and Association Analysis with Characters
[0062] 1. Using the detection method for the TNNC2 gene INDEL mutation established in Example 2, in the three hybrid combinations (DLC, DDLC, DLLC) of the "Zhuangxiang black pig" population (Group 1) and the lean commercial hybrid population Polymorphism detection was carried out in the three cross combinations (PLY, DLY, PDLY) of (Group 2). The results are shown in Table 1.
[0063] Table 1 Allele frequency of INDEL mutation of TNNC2 gene in different populations
[0064]
[0065] The results showed that in the "Zhuangxiang black pig" group (Group 1), individuals with BB and AB genotypes were dominant, and individuals with AA genotype were less; Individuals with the genotype are dominant, and individuals with the BB genotype are less.
[0066] 2. In order to detect the existence of the INDEL mutation of the TNNC2 gene in different purebred individuals, collected Landrace, Yorkshir...
PUM
![No PUM](https://static-eureka.patsnap.com/ssr/23.2.0/_nuxt/noPUMSmall.5c5f49c7.png)
Abstract
Description
Claims
Application Information
![application no application](https://static-eureka.patsnap.com/ssr/23.2.0/_nuxt/application.06fe782c.png)
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap