Rape pod shatter relevant gene, molecular marker and application

A gene and rapeseed technology, which is applied to the related genes and molecular markers of rapeseed angle and in the fields of crop genetic breeding and physiology, can solve the problems of unutilized key genes and functional molecular markers, and achieves speeding up the rapeseed breeding process and screening. The effect of progress and broad application prospects

Active Publication Date: 2017-10-31
INST OF OIL CROPS RES CHINESE ACAD OF AGRI SCI
View PDF3 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] In recent years, with the rapid development of molecular biology in rapeseed, many QTLs controlling cleavage angle have been located, but the key genes and functional molecular markers corresponding to the anti-cleavage angle QTL loci have not been reported, and analysis and research have been done. Natural genetic variation of genes related to silique dehiscence, studying its mechanism and adjusting the resistance of rapeseed to silique dehiscence by means of molecular biology has become an important breakthrough in the genetic improvement of rapeseed

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Rape pod shatter relevant gene, molecular marker and application
  • Rape pod shatter relevant gene, molecular marker and application
  • Rape pod shatter relevant gene, molecular marker and application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0039] Example 1: Acquisition of rapeseed horn-related gene BnSHP1-A9:

[0040] 1. Location and cloning of qSRI.A9.1

[0041] (1) Field experiment and phenotypic determination of anti-cracking angle index:

[0042] Field experiments were conducted at the Yangluo Experimental Station (Wuhan) of the Oil Plant Research Institute of the Chinese Academy of Agricultural Sciences from 2013 to the autumn of 2014. The crack angle resistance index (SRI) of the strains or individual plants was investigated at the mature stage. The identification method refers to patent 201310226680.4. Specifically, the rape siliques were dried at 80°C for 30 minutes, sealed and stored at room temperature overnight, then placed in a cylindrical container, and 8 steel balls were placed in the cylindrical container; the cylindrical container was shaken at a speed of 280rpm using a model HQ45Z shaker. Observe once every two minutes, observe 5 times in total, repeat 3 times for each material, use the formula...

Embodiment 2

[0056] Example 2: Differential expression analysis of BnSHP1-A9 was carried out by sampling the corresponding parts of the R1 and R2 siliques at different developmental stages.

[0057] From different flower buds to flowering, until the formation of siliques at different stages of development, taking the initial stage of rapeseed flowering as the standard, sampling every 2 days after the formation of siliques 10 days after pollination, according to the development period of siliques, each material in each period is parallel Five plants with uniform development and size of siliques were selected as five biological replicates, and the cut siliques contained the same proportion of detached tissues as much as possible. Use RNAprep pure Plant Kit (TIANGEN) to extract total RNA, and then use Hiscript @ II 1 st The strandcDNA synthesis kit reverse-transcribes RNA into first-strand cDNA, using 2×Es Taq MasterMix (CWBIO), BIO-RAD S1000 TM Thermal Cycler instrument for RT-PCR reacti...

Embodiment 3

[0059] Example 3: Construction of Rapeseed BnSHP1-A9-R1 Suppression Expression Vector and Transformation in Rapeseed

[0060] According to the BnSHP1-A9 coding region sequence of R1 material, primers were designed to amplify part of the coding region fragment (143bp). The primer sequences were: TTCTTTTCGGTGGTTTTATTC and TGACGATTTGTTGTGTTCTCT. It was reverse ligated to the topo vector and recombined into pEarleyGate100. Transformation of the vector into LBA4404 is ready for transformation of canola.

[0061] Transformation of Rapeseed with Agrobacterium LBA4404

[0062] A. Preparation of sterile seedlings: Seeds were soaked in 70% ethanol for 1 min, mercuric chloride (HgCl 2 ) for 13-15 min, ddH 2 O washed 5 times, and spread in MS medium (PH 5.8), agar concentration 0.8%. Rapeseed aseptic seedlings for use.

[0063] B. Rapeseed petiole transformation: inoculate Agrobacterium tumefaciens LBA4404 on solid medium LB, pick a single colony after two days and cultivate in 50ml YE...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a rape pod shatter relevant gene, a molecular marker and application. An applicant positions a negative effect QTL site for controlling the anti-pod-shatter effect on rape A09 for the first time; 11.26 to 12.07 percent of phenotypic variance can be explained; a pair of InDel marks (IF4 / IR4) are further developed by using the differences of R1 and R2 genomes; pod anti-pod-shatter different QTL sites are detected through gene function marks; and elimination can be performed in the seedling period, so that the production cost is reduced, and the selection efficiency is greatly improved. The positions of function genes of the anti-pod-shatter negative effect QTL site are specific; a detection method is convenient and fast; and the environment influence is avoided. The anti-pod-shatter performance of breeding materials can be predicted through detecting the anti-pod-shatter property function molecular marker; and an anti-pod-shatter rape strain can be further accurately and fast screened.

Description

technical field [0001] The invention relates to the field of genetic engineering, in particular to genes and molecular markers related to rape cleavage horns and their application in crop genetic breeding and physiology. Background technique [0002] Rapeseed is an important oil crop in my country. At present, the problem of machine harvesting and shattering of rapeseed seriously limits the improvement of the mechanized production level of rapeseed. Improving the resistance of rape cultivars to cracking horns is one of the important breeding goals at this stage. Quantitative genetics and molecular biology were used to locate and clone genes related to horn-splitting resistance, which not only provided a theoretical basis for the study of the molecular mechanism of horn-splitting resistance in rapeseed, but also laid a solid foundation for molecular marker-assisted selection to breed horn-splitting-resistant varieties. At present, the anti-cracking horn genes that can be used...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N15/29C12N15/11C12Q1/68
CPCC07K14/415C12Q1/6895C12Q2600/13C12Q2600/156
Inventor胡琼刘佳周日金汪文祥王会李云昌梅德圣付丽
OwnerINST OF OIL CROPS RES CHINESE ACAD OF AGRI SCI