High speed nucleic acid amplification method, and equipment and application thereof

A nucleic acid and extremely fast technology, applied in biochemical equipment and methods, specific-purpose bioreactors/fermenters, microbial measurement/inspection, etc., can solve the problem of low efficiency of PCR instruments, affecting work efficiency, and long reaction time and other issues, to achieve maximum flexibility and applicability, save time, and achieve the effect of rapid nucleic acid detection

Active Publication Date: 2019-08-09

GUANGZHOU ANGEL BIOSAFETY TECH CO LTD

6 Cites 1 Cited by

AI-Extracted Technical Summary

Problems solved by technology

However, because the current PCR process still has a long reaction time and needs batch reactions, that is, the problem of a long cycle, the next batch of react...

Method used

Visible by the result of embodiment 3-5, the PCR method mediated by conventional PCR method and extreme ambient temperature can effectively realize PCR amplification to different size short gene fragments; Extreme ambient temperature mediated PCR method at 8-12min High-efficiency and ultra-fast amplification can be achieved within a short period of time, and the time can be shortened to abo...

Abstract

The invention discloses a high speed nucleic acid amplification detection method. A nucleic acid amplification reaction tube is repeatedly placed in an ultrahigh temperature zone and an ultralow temperature zone for a short period; the temperature of the ultrahigh temperature zone is in a range of 100 to 150 DEG C; the temperature of the ultralow temperature zone is in a range of 10 to 40 DEG C; after 30 to 45 cycles, and the nucleic acid amplification detection is completed within 8 to 15 minutes. The invention also discloses a reactor for the high speed nucleic acid amplification, which comprises an ultrahigh temperature reaction zone with a fixed temperature in a range of 100 to 150 DEG C and an ultralow temperature reaction zone with a fixed temperature in a range of 10 to 40 DEG C. The invention also discloses an operation software system and equipment for the high speed nucleic acid amplification.

Application Domain

Bioreactor/fermenter combinationsBiological substance pretreatments +5

Technology Topic

BiologyReaction tube +4

Image

Examples

Experimental program(6)

Example Embodiment

[0026] Embodiment 1 Preliminary test of the effect of high temperature ambient temperature on the temperature change rate of temperature rise

[0027] A preliminary test of the effect of ambient temperature on the temperature change efficiency is carried out. The specific operations are as follows:

[0028] Set the temperature of the reaction well of the PCR instrument to 100 °C, and use a spot thermometer to test the initial temperature of the liquid in the PCR reaction tube to 60 °C. Place the reaction tube in the reaction well of the PCR instrument. When the temperature of the liquid in the PCR reaction tube reaches At 92°C, it took 14 seconds.

[0029] Set the temperature of the reaction well groove of the PCR instrument to 95 °C, and use a spot thermometer to test the initial temperature of the liquid in the PCR reaction tube to 60 °C. Place the reaction tube in the reaction well groove of the PCR instrument. When the temperature of the liquid in the PCR reaction tube reaches At 92°C, it took 22 seconds.

[0030]Set the temperature of the reaction well of the special thermometer module to 130 °C, and use a spot thermometer to test the initial temperature of the liquid in the PCR reaction tube to be 60 °C. Place this reaction tube in the reaction well of the PCR instrument. It took 6 seconds for the temperature of the liquid to reach 92°C.

[0031] Set the temperature of the reaction well tank of the special thermometer module to 150 °C, and use a spot thermometer to test the initial temperature of the liquid in the PCR reaction tube to be 60 °C. Place this reaction tube in the reaction well tank of the PCR instrument. When the temperature of the liquid reaches 92°C, it takes 5 seconds.

[0032] Through the above tests, the following conclusions are drawn: when the ambient temperature is 150°C, the temperature change rate is 6.4°C/sec from 60°C to 92°C; When the temperature reaches 92℃, the temperature change rate is 5.3℃/sec; in the case of 100℃ ambient temperature, when the temperature rises from 60℃ to 92℃, the temperature change rate is 2.13℃/sec; in the case of 95℃ ambient temperature , from 60 ℃ to 92 ℃, the temperature change rate is 1.45 ℃ / sec.

[0033] The above conclusion shows that when the reaction solution with the same initial temperature is heated with the same gradient, the greater the difference between the ambient temperature and the initial temperature of the reaction solution, the faster the temperature change rate of the actual temperature increase in the reaction solution.

Example Embodiment

[0034] Embodiment 2 Preliminary test of the influence of low temperature ambient temperature on the temperature change rate of cooling

[0035] A preliminary test of the effect of ambient temperature on the temperature change efficiency is carried out. The specific operations are as follows:

[0036] Set the temperature of the reaction well groove of the PCR instrument to 10 °C, and use a spot thermometer to test the initial temperature of the liquid in the PCR reaction tube to 92 °C. Place the reaction tube in the reaction well groove of the PCR instrument. When the temperature of the liquid in the PCR reaction tube drops It took 4 seconds to reach 60°C.

[0037] Set the temperature of the reaction well groove of the PCR instrument to 20 °C, and use a spot thermometer to test the initial temperature of the liquid in the PCR reaction tube to 92 °C. Place the reaction tube in the reaction well groove of the PCR instrument. When the temperature of the liquid in the PCR reaction tube drops When it reaches 60°C, it takes 5 seconds.

[0038] Set the temperature of the reaction well groove of the PCR instrument to 40 °C, and use a spot thermometer to test the initial temperature of the liquid in the PCR reaction tube to 92 °C. Place the reaction tube in the reaction well groove of the PCR instrument. When the temperature of the liquid in the PCR reaction tube drops It took 8 seconds to reach 60°C.

[0039] Set the temperature of the reaction well of the PCR instrument to 45 °C, and use a spot thermometer to test the initial temperature of the liquid in the PCR reaction tube to 92 °C. Place this reaction tube in the reaction well of the PCR instrument. When the temperature of the liquid in the PCR reaction tube drops At 60°C, it took 11 seconds.

[0040] Set the temperature of the reaction well groove of the PCR instrument to 60 °C, and use a spot thermometer to test the initial temperature of the liquid in the PCR reaction tube to 92 °C. Place the reaction tube in the reaction well groove of the PCR instrument. When the temperature of the liquid in the PCR reaction tube drops At 60°C, it took 45 seconds.

[0041] Through the above tests, the following conclusions are drawn: in the case of an ambient temperature of 10°C, the actual temperature change rate is 8°C/sec from 92°C to 60°C; in the case of an ambient temperature of 20°C, the temperature is reduced from 92°C to 60°C. When the temperature reaches 60℃, the actual temperature change rate is 6.4℃/second; when the ambient temperature is 40℃, the actual temperature change rate is 4℃/second from 92℃ to 60℃; at the ambient temperature of 45℃ In the case of 92℃ to 60℃, the actual temperature change rate is 2.9℃/sec; in the case of 60℃ ambient temperature, the actual temperature change rate is 0.7℃ when it drops from 92℃ to 60℃ /second.

[0042] The above conclusion shows that when the reaction solution with the same initial temperature is cooled with the same gradient, the greater the difference between the ambient temperature and the initial temperature of the reaction solution, the faster the temperature change rate of cooling.

Example Embodiment

[0043] Embodiment 3 A preferred embodiment of the comparative experiment between the extreme-speed PCR method and the conventional PCR method

[0044] Four groups of different short fragments of the hepatitis B virus (HBV) gene were used as target fragments for amplification, and the ultra-fast PCR method was used to compare with the conventional PCR method.

[0045] 1. The four groups of target amplification sequences and the corresponding forward and reverse primer sequences are as follows:

[0046] The first group of target amplification sequences SEQ ID NO: 1:

[0047] 5’-CCCCAACCTCCAATCACTCACCAACCTCTTGTCCTCCAATTTGTCCTGGTTATCGCTGGATGTGTCTGCG-3’

[0048] The first group of forward primers SEQ ID NO: 2: 5'-CCCCAACCTCCAATCACTCA-3'

[0049] The first set of reverse primers SEQ ID NO: 3: 5'-CGCAGACACATCCAGCGATAAC-3'

[0050] The second set of target amplification sequences SEQ ID NO: 4:

[0051] 5’-CCCCAACCTCCAATCACTCACCAACCTCTTGTCCTCCAATTTGT CCTGGTTATCGCTGGATGTGTCTGCGGCGTTTTTATCATCTTCCTCTTCAT CCTGCT-3’

[0052] The second set of forward primers SEQ ID NO: 5: 5'-CCCCAACCTCCAATCACTCA-3'

[0053] The second set of reverse primers SEQ ID NO: 6:

[0054] 5’-AGCAGGATGAAGAGGAAGATGATAAA-3’

[0055] The third set of target amplification sequences SEQ ID NO: 7:

[0056] 5’-CCCCAACCTCCAATCACTCACCAACCTCTTGTCCTCCAATTTGT CCTGGTTATCGCTGGATGTGTCTGCGGCGTTTTTATCATCTTCCTCTTCAT CCTGCTGCTATGCCTCATCTTCTTGTTGGTTCTTCTGGACTACCAAGGT ATGTTGC-3’

[0057] The third set of forward primers SEQ ID NO: 8: 5'-CCCCAACCTCCAATCACTCA-3'

[0058] The third set of reverse primers SEQ ID NO: 9:

[0059] 5'-GCAACATACCTTGGTAGTCCAGAAG-3'

[0060] The fourth group of target amplification sequences SEQ ID NO: 10:

[0061] 5’-CCCCAACCTCCAATCACTCACCAACCTCTTGTCCTCCAATTTGT CCTGGTTATCGCTGGATGTGTCTGCGGCGTTTTTATCATCTTCCTCTTCAT CCTGCTGCTATGCCTCATCTTCTTGTTGGTTCTTCTGGACTACCAAGGT ATGTTGCCCGTTTGTCCTCTACTTCCAGGAACATCAA-3’

[0062] The fourth group of forward primers SEQ ID NO: 11: 5'-CCCCAACCTCCAATCACTCA-3'

[0063] The fourth set of reverse primers SEQ ID NO: 12:

[0064] 5’-TTGATGTTCCTGGAAGTAGAGGACA-3’

[0065] 2. The reaction solution of the PCR reaction system is prepared as follows, wherein the PCR reaction buffer is selected from the products of TAKARA Company:

[0066]

[0067]

[0068] 3. The routine PCR reaction procedure is as follows:

[0069]

[0070] 4. The PCR experiment reaction mediated by extreme ambient temperature is as follows:

[0071] An independent high temperature module and a low temperature module were used as reaction environment temperature brackets for the PCR reaction, wherein the temperature of the high temperature module was set to 100°C, and the temperature of the low temperature module was set to 10°C.

[0072] Place the thermometer in the PCR reaction tube to measure the temperature of the reaction solution in the PCR tube.

[0073] With reference to the experimental results obtained in Examples 1 and 2, place the PCR tube in an independent 100°C high temperature tank, and measure the temperature of the reaction solution in the PCR tube from 60°C (±3°C) to 92°C (±3°C). Place the PCR tube in a separate 10°C low temperature tank, and measure the temperature of the reaction solution in the PCR tube from 92°C (±3°C) to 60°C (±3°C), which takes 4s. Therefore, we designed the reaction procedure for the extreme ambient temperature-mediated PCR experiment as follows:

[0074]

[0075] The temperature of the reaction solution in the PCR tube is 92°C (±3°C) when the PCR tube is placed in a 100°C independent high temperature tank, and the lowest temperature is 60°C (±3°C) when the PCR tube is placed in a 10°C independent high temperature chamber .

[0076] Manually move the PCR reaction tube between the high temperature tank and the low temperature tank, so that the actual temperature of the reaction solution in the PCR reaction tube is repeatedly cycled at 60-92°C (±3°C) to achieve the amplification of target gene fragments.

[0077] The experimental results show that the conventional PCR method takes about 1 hour and 25 minutes, and the PCR reaction mediated by extreme ambient temperature takes about 10 minutes. The amplification effects of the two methods were detected by 2% agarose gel electrophoresis. The results of electrophoresis are shown in figure 1 , figure 1 The electrophoresis results of the amplified fragments with lengths of 70bp, 100bp, 150bp and 180bp, respectively, and the PCR amplification products mediated at extreme ambient temperatures of 100°C and 10°C are shown. Lane M is the molecular weight standard reference, lane 1 is the electrophoresis result of conventional PCR products, and lane 2 is the electrophoresis result of PCR products mediated by extreme ambient temperature.

[0078] Depend on figure 1 The results show that the PCR amplification detection process mediated by extreme ambient temperature can be completed in about 11 minutes, and the amplification effect can reach the similar effect of conventional PCR amplification detection.

PUM

Description & Claims & Application Information

We can also present the details of the Description, Claims and Application information to help users get a comprehensive understanding of the technical details of the patent, such as background art, summary of invention, brief description of drawings, description of embodiments, and other original content. On the other hand, users can also determine the specific scope of protection of the technology through the list of claims; as well as understand the changes in the life cycle of the technology with the presentation of the patent timeline. Login to view more.

Classification and recommendation of technical efficacy words

shorten the time
increase usage

High speed nucleic acid amplification method, and equipment and application thereof

AI-Extracted Technical Summary

Problems solved by technology

Method used

Abstract

Image

Examples

Example Embodiment

Example Embodiment

Example Embodiment

PUM

Description & Claims & Application Information

Similar technology patents

Method, device and equipment for circularly issuing coupons based on a block chain and a storage medium

Coupler and manufacturing method thereof

Circuit structure for conducting least square equation solving according to positive definite symmetric matrices

Paper class processing device and automatic trading device

Mosaic wood cold press

Classification and recommendation of technical efficacy words

Method, device and system for establishing neighbor relation

Mobile terminal and method for adjusting visual effect of screen thereof

Method and apparatus for loading web pages

Aqueous chromium-free zinc and aluminum coating and preparation method thereof

Airline planning method and device for surveying and mapping unmanned aerial vehicle

Cooling fan

Mobile communication terminal and wireless communication system

Method of using buffer area

Memo method and communication terminal

Serial Peripheral Interface (SPI) controller and communication method