Unlock instant, AI-driven research and patent intelligence for your innovation.

Method for quickly detecting rice bakanae pathogen F.fujikuroi based on RPA

A technology for Fusarium Fujikura and pathogenic bacteria, which is applied in the field of plant protection, can solve the problems of low detection result accuracy, long detection time, and dependence on sophisticated instruments and equipment, and achieves the effect of high specificity and sensitivity

Inactive Publication Date: 2019-08-13
CHINA AGRI UNIV
View PDF2 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the accuracy of the detection results of these technologies is low, the detection takes a long time, or relies on sophisticated instruments and equipment, etc.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for quickly detecting rice bakanae pathogen F.fujikuroi based on RPA
  • Method for quickly detecting rice bakanae pathogen F.fujikuroi based on RPA

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0060] Example 1, RPA detection nucleotide primer combination screening of rice bakanae pathogen Fusarium fujikura

[0061] 1. Primer design

[0062] 1. A large number of sequence analyzes and comparisons were carried out to obtain 6 primers (as shown in Table 1) for detecting the rice bakanae pathogen Fusarium fujikura.

[0063] Table 1 The sequence of RPA primers used to detect the rice bakanae pathogen Fusarium fujikura

[0064] Primer name Primer sequence (5'-3') F1 CCATTCAACACATACATCCGCCACCTCACT F2 CAACACATACATCCGCCACCTCACTGAACAAGAC F3 ACATACATCCGCCACCTCACTGAACAAGAC R1 CTAGGAGATGGTCGCTTAGAGTAGGTAGATCAAGG R2 TTCGTTGGATCGTATCTGTAGCCGAGGATTGGT R3 CTAGGAGATGGTCGCTTAGAGTAGGTAGATCAAGG

[0065] 2. Combine the 6 primers designed in step 1 into 3 pairs of primer combinations (as shown in Table 2).

[0066] Table 2 RPA primer combination and product size

[0067] Numbering Primer combination Product size (bp) ...

Embodiment 2

[0086] Embodiment 2, specificity

[0087] Tested strains: rice bakanae pathogen Fusarium fujikura, rice sheath blight Rhizoctonia solani, rice koji, rice blast fungus, wheat head blight fungus Fusarium graminearum and wheat equisetum.

[0088] 1. Inoculate the strain to be tested on a PDA plate, culture in the dark at 25°C for 7 days, scrape the mycelium with a sterile inoculation needle into a sterile centrifuge tube, and extract the DNA of the mycelium by CTAB method.

[0089] 2. Extract the total DNA of healthy rice leaves.

[0090] 3. Get the DNA sample that steps 1 and 2 obtain, take described DNA sample as template, adopt the primer that primer F and primer R form to carry out RPA reaction (reaction method sees step 2 and 3 of second part in embodiment 1) . Set to use ddH 2 0 as a negative control group for the template.

[0091] The result is as figure 1 shown. The results show that only the RPA amplification product corresponding to the rice bakanae pathogen Fusa...

Embodiment 3

[0092] Embodiment 3, sensitivity

[0093] 1. Inoculate the rice bakanae pathogen Fusarium Fujikura on a PDA plate, culture in the dark at 25°C for 7 days, scrape the mycelium with a sterile inoculation needle into a sterile centrifuge tube, and extract the DNA of the mycelium by CTAB method (the DNA concentration is 861.9 ng / μL).

[0094] 2. The mycelia DNA obtained in step 1 was diluted step by step with a 10-fold gradient, respectively 10 -1 、10 -2 、10 -3 、10 -4 、10 -5 、10 -6 A total of 6 dilutions, resulting in concentrations of 86.19ng / μL, 8.619ng / μL, 8.619×10 -1 ng / μL, 8.619×10 -2 ng / μL, 8.619×10 -3 ng / μL and 8.619×10 -4 ng / μL DNA solution.

[0095] 3. Using the DNA samples that were diluted in different gradients in step 2 as a template, a primer pair consisting of primer F and primer R was used to perform RPA reaction (see steps 2 and 3 in the second part of Example 1 for the reaction method).

[0096] Set to use ddH 2 0 as a negative control group for the t...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a method for quickly detecting rice bakanae pathogen F.fujikuroi based on RPA. A primer pair is composed of two primers shown in the sequence 1 and the sequence 2 in a sequencelist. The invention further builds a quick detection method for the rice bakanae pathogen F.fujikuroi. The designed primers can effectively amplify the target gene, the method is higher in specificity and sensitivity, capable of being used for quick detection of the rice bakanae pathogen F.fujikuroi, and capable of precisely preventing and controlling occurrence and prevalence of the disease.

Description

technical field [0001] The invention relates to the field of plant protection, in particular to a method for rapidly detecting rice bakanae pathogen Fusarium fujikura based on RPA. Background technique [0002] Rice bakanae disease (rice bakanae disease) is one of the fungal diseases that seriously affect the growth and development of rice. It is transmitted through infected seeds, and diseased rice straw is also its main source of primary infection. It is widely distributed in our country, and it can cause more than 50% reduction in rice production when it occurs seriously. The main symptoms are that the leaf sheath leaves are long and narrow, the leaf color is light yellow, the affected plants are leggy, thinner and taller than healthy plants, and the root system is poorly developed, the root length becomes shorter and there are inverted roots, and there are few root hairs. After the rice seeds germinate, the pathogen infects the seedlings from the bud sheaths, roots and ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/11C12Q1/6895C12Q1/6844C12Q1/04
CPCC12Q1/6895C12Q1/6844
Inventor 范在丰马文娣田逸英焦志远任彬元杨普云倪运东李爱国
Owner CHINA AGRI UNIV