Check patentability & draft patents in minutes with Patsnap Eureka AI!

Application of exosome miRNA to preparation of liver cancer diagnosis products

A technology of exosomes and products, applied in the field of biomedicine, can solve problems such as relying on tissue biopsy, achieve convenient non-invasive diagnosis methods, improve sensitivity and specificity, and be easy to detect

Inactive Publication Date: 2019-08-20
ZHEJIANG UNIV
View PDF0 Cites 5 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, as a structure inside the nucleus, the detection of PNC depends on tissue biopsy

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of exosome miRNA to preparation of liver cancer diagnosis products
  • Application of exosome miRNA to preparation of liver cancer diagnosis products

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0037] Example 1 Preparation of exosomes

[0038] When the liver cancer cell lines Huh7 and HepG2, and the normal liver cell line HL-7702 were conventionally cultured to a density of about 40%, they were washed twice with PBS and then cultured in a culture system supplemented with exosome-free serum. After 48 hours, the cell supernatant was collected, and the exosomes were separated and prepared by ultracentrifugation. Centrifuge at 300g at 4°C for 10 minutes; take the supernatant and centrifuge again (4°C, 2000g, 10 minutes); take the supernatant and centrifuge again (4°C, 10,000g, 30 minutes). The precipitate was discarded, and the supernatant was centrifuged at 100,000g for 70 minutes; the collected precipitate was resuspended in PBS, and then centrifuged again (100,000g, 70 minutes), and the obtained precipitate was cell exosomes.

[0039] Collect anticoagulant and non-anticoagulant blood from patients or medical examiners, centrifuge at 2000 rpm for 10 minutes at 4°C, se...

Embodiment 2

[0040] Example 2 Identification of exosomes

[0041]The particle size of cell supernatant and plasma or serum exosomes was analyzed by NTA method (Nanoparticle Tracking Analysis: nanoparticle tracking analysis method). The particle size range is 35-135nm. The exosome markers on the surface were detected by Western Blot or magnetic bead method (flow cytometry). Western Blot detection showed that the isolated Huh7 cells and the plasma and serum exosomes of patients with liver cancer all expressed CD63, CD9 and CD81.

Embodiment 3

[0042] Example 3 Analysis of the expression level of exosome miR-1283

[0043] Exosomes from Huh7, HepG2 and HL-7702 cells, or serum exosomes from liver cancer patients and healthy controls were collected. Resuspended with 200 μL of PBS and placed on ice, added 200 μL of 2X Denaturing Solution from Thermo Fisher Company to mix well, and then added 25 fmol of external reference Cel-miR-39. Then, miRVanamiRNA extraction kit from Thermo Fisher Company was used to separate and prepare serum exosomal miRNA. Then, the miRNA reverse transcription kit was used to perform reverse transcription using the reverse transcription primer of miR-1283 (SEQ ID No. 2: CAGCATAGGTCACGCTTATGGAGCCTGGGACGTGACCTATGCTGAGAAAG), and the reaction program was: 42°C for 15 minutes, 85°C for 5 seconds. The PCR detection primer pair of miR-1283 was then used for fluorescent quantitative PCR detection. The PCR system was: 2×SYBR Green Mix-10 μl; miR-1283 upstream primer (SEQ ID No.3: GCCGGGTCTACAAAGGAAAGCG) 5...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
Particle sizeaaaaaaaaaa
Particle sizeaaaaaaaaaa
Login to View More

Abstract

The invention provides an application of blood exosome miR-1283 to preparation of liver cancer diagnosis products. The sequence of the blood exosome is as shown in SEQID No.1. According to the application disclosed by the invention, a mouse liver cancer metastasis model through liver cancer cell strains, and the situation that the PNC proportion of metastasis liver cancer cells is far higher thanthat of in situ site is found. Metastasis liver cancer tissue and in situ site liver cancer tissue are separated for cell culture, then exosome miRNA components of two cell culture supernatants are subjected to chip analysis, and exosomes significantly rise in liver cancer cells high in PNC proportion. The blood exosomes are novel biological markers. Prepared products are stable, minimally invasive, easy to detect, and quantitative and precise, sensibility and specificity of disease diagnosis can be increased, diagnosis and metastasis risk early warning are facilitated, reference is provided for developing other tumor similar biological markers, and a convenient noninvasive diagnosis manner is provided for metastasis early warning and prognosis assessment of liver cancer based on PNC.

Description

technical field [0001] The invention belongs to the field of biomedicine and relates to cancer diagnosis products, in particular to the application of exosome miRNA in the preparation of liver cancer diagnosis products, wherein the exosome miRNA is blood exosome miR-1283. Background technique [0002] Liver cancer is one of the common malignant tumors in human beings, and its mortality rate has always been high, ranking third among all tumor-related causes of death. The main reasons are as follows: First, the base is huge. There are 500,000 to 1 million new cases worldwide every year, and about 700,000 people die of liver cancer, and the 5-year mortality rate exceeds 90%. More than half of the global liver cancer cases are in China, so liver cancer has a high incidence and high risk in my country. The recurrence rate of liver cancer patients after treatment is high, according to statistics, the recurrence rate is as high as 60-70% within 5 years after surgery. Among them, ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/6886
CPCC12Q1/6886C12Q2600/118C12Q2600/158C12Q2600/178
Inventor 郑敏刘艳宁楼国华陈智
Owner ZHEJIANG UNIV
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More