SNP molecular markers linked to tea tree caffeine content of and its application

A technology of molecular markers and caffeine, which is applied in the field of molecular genetics and breeding, can solve the problems of affecting the content of caffeine and failing to find it

Active Publication Date: 2019-11-05
TEA RES INST GUANGDONG ACAD OF AGRI SCI
View PDF2 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0006] The discovery of molecular markers closely linked to the excellent traits of tea trees is the basis for molecular marker-assisted selection breeding of tea trees. However, due to the limitations of traditional QTL mapping research progress, it has not been possible to find SNP molecular markers that affect caffeine content.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • SNP molecular markers linked to tea tree caffeine content of and its application
  • SNP molecular markers linked to tea tree caffeine content of and its application
  • SNP molecular markers linked to tea tree caffeine content of and its application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0067] 1. Experimental samples

[0068] Collected 191 tea tree materials located in the Guangdong Tea Tree Germplasm Resource Bank (Guangdong, Yingde, 113.3OE, 24.3ON), including 124 in Guangdong, 20 in Fujian, 15 in Guangxi, 9 in Zhejiang, 6 in Hunan, and 6 in Yunnan 1 copy in Jiangxi, 1 copy in Guizhou, and 1 copy in Taiwan. In addition, 8 descendants of Kenyan tea species and 1 descendant of Georgian species, the selected materials are widely representative.

[0069] The selected resources are randomly distributed in the resource pool. Single planting in double rows, each row 4m, row spacing 1.5m, plant spacing 35cm. The resource bank conducts routine water and fertilizer management. At the end of 2016, the resources were pruned and basal fertilizer was applied in deep pits, 4 tons of organic fertilizer, 0.75 tons of peanut bran and 10 catties of compound fertilizer per mu. After spring tea and summer tea in 2017, pruning and topdressing outside the roots, 30 catties of...

Embodiment 2

[0093] Example 2 Verification of SNP sites

[0094] 1. Experimental method

[0095] SNP site 1 (Scaffold115: 803980) and SNP site 2 (Scaffold720: 596655) were verified in another population containing 98 germplasm.

[0096] 1. Detect the caffeine content of each sample. The specific detection method is the same as in Example 1.

[0097] 2. Use the SnaPShot technology platform to detect the SNP sites 1 (Scaffold115: 803980) and 2 (Scaffold720: 596655) of each sample.

[0098] This method designs primers of different lengths for different mutation sites. After the SNaPshot reaction, the products are separated by electrophoresis, detected by five-color fluorescence, and analyzed by Gene mapper. Multiple SNP sites can be detected in one sequencing reaction. Using SNaPshot for fixed-point sequence analysis, its basic principle follows the dideoxy termination method in direct DNA sequencing, the difference is that there are only different fluorescently labeled ddNTPs in the PCR r...

Embodiment 3

[0145] Embodiment 3 A kind of test kit for evaluating tea tree caffeine content

[0146] 1. Composition

[0147] The nucleotide sequence of which is shown in SEQ ID NO: 2-3 as the primer for detecting SNP site 1 or / and the nucleotide sequence of which is shown in SEQ ID NO: 5-6 as the primer for detecting SNP site 2, 2×Taq PCR Master Mix, ddH 2 O.

[0148] Wherein, SNP site 1 primer F: CTTCATCTCCACCACACTTC (SEQ ID NO: 2);

[0149] SNP site 1 primer R: GCCCAAAGTAGCAAAGAGAG (SEQ ID NO: 3).

[0150] SNP site 2 primer F: CAACTTTGGTGATGACGGAC (SEQ ID NO: 5);

[0151] SNP site 2 primer R: TTCAACTGGTGTGTAGACGC (SEQ ID NO: 6).

[0152] 2. How to use

[0153] (1) Extract the total DNA of tea tree shoots by the CTAB method, and ensure that the A260 / A280 of each DNA sample is between 1.8 and 2.0, and the concentration is greater than 100 μg / μl;

[0154] (2) PCR amplification

[0155] The detection primers whose nucleotide sequences are shown in SEQ ID NO: 2-3 and SEQ ID NO: 5-6 a...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention discloses a set of SNP molecular markers linked to tea tree caffeine (CAF) content and an application thereof. The application finds for the first time that by SNP molecular marker sitesassociated with the caffeine content of the tea tree at the Scaffold 115:803980 and Scaffold 720:596655 sites on a tea tree genome, the genotype is extremely significantly related to the content of caffeine. Further, a detection method for detecting each site is established, and one or several molecular markers can be used to evaluate the caffeine content of the tea tree, the method can be used for the tea tree resource screening and molecular breeding for different caffeine levels, and has great research value.

Description

technical field [0001] The invention relates to the technical field of molecular genetic breeding, more specifically, to a SNP molecular marker linked with the caffeine content of tea trees and its application. Background technique [0002] Tea (Camellia sinensis (L.) O.Kuntze) belongs to the tea group of the genus Camellia in the family Theaceae, originated in the southwestern region of China, and has a cultivation history of more than 5,000 years ago. Tea, coffee, and cocoa are known as the world's three major non-alcoholic beverages, which have important economic value and have an important impact on society and culture. [0003] The characteristic secondary metabolite caffeine (CAF) in new shoots of tea tree is one of the main factors affecting the taste of tea. Caffeine is a kind of alkaloid with high content in tea leaves, the general content is 2 to 5%, and each cup of 150ml tea soup contains about 40mg of caffeine. Caffeine is a central nervous system stimulant, so...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
IPC IPC(8): C12Q1/6895C12N15/11
CPCC12Q1/6895C12Q2600/13C12Q2600/156
Inventor 吴华玲方开星李红建姜晓辉秦丹丹王秋霜潘晨东李波黄华林
Owner TEA RES INST GUANGDONG ACAD OF AGRI SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap