Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Zacco platypus DNA barcode sequence and application thereof

A barcode and sequence technology, which is applied in the field of species identification, can solve the problems of lack of COI gene and difficulty in identification of the broadfin lapfish, and achieves the effect of simple method, few steps, and convenient comparison.

Pending Publication Date: 2019-11-12
JIANGHAN UNIVERSITY
View PDF4 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

There may be morphological differences such as body length and body color in different groups of broadfin carp, which brings certain difficulties to the identification of broadfin carp. Therefore, it is necessary to carry out accurate and effective identification
[0006] In the existing technology, there is no record and report of the standard detection sequence of the DNA barcode of the broadfin and the COI gene of the broadfin as the standard detection sequence of the DNA barcode of the broadfin

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0017] Five samples of broadfin carp from the Shaonuping section of the Xiangjiaba reservoir area in the lower reaches of the Jinsha River were taken for verification.

[0018] 1. Extraction of DNA

[0019] Cut about 5mg of fish muscle tissue, shred it as much as possible, put it in a 1.5ml centrifuge tube, and place it at room temperature. After the ethanol is completely evaporated, use the cell / tissue genome kit of GENEray company to extract genomic DNA. .

[0020] 2. PCR amplification

[0021] The general primers of COI gene in Cyprinidae fish were used as PCR primers. The sequences of the upstream and downstream primers were: CypFCOI: tctcaaccaaccacaaagacattgg, CypRCOI: gacttctgggtggccaaagaatca. The total volume of the PCR reaction system was 50 μl, and a PCR kit was used for PCR amplification. The specific components are shown in Table 1, and the PCR reaction procedure is shown in Table 2.

[0022] Table 1 PCR reaction system

[0023] reactive component Vol...

Embodiment 2

[0033] 1. Extraction of DNA

[0034] Cut about 5mg of fish muscle tissue, shred it as much as possible, put it in a 1.5ml centrifuge tube, and place it at room temperature. After the ethanol is completely evaporated, use the cell / tissue genome kit of GENEray company to extract genomic DNA. .

[0035] 2. PCR amplification

[0036] The general primers of COI gene in Cyprinidae fish were used as PCR primers. The sequences of the upstream and downstream primers were: CypFCOI: tctcaaccaaccacaaagacattgg, CypRCOI: gacttctgggtggccaaagaatca. The total volume of the PCR reaction system was 50 μl, and a PCR kit was used for PCR amplification. The specific components are shown in Table 1, and the PCR reaction procedure is shown in Table 2.

[0037] 3. Agarose gel electrophoresis detection

[0038] Perform electrophoresis on the PCR product at a constant voltage of 5 V / cm, and stop the electrophoresis when the bromophenol blue moves to about 5 cm from the front of the agarose gel. The ...

Embodiment 3

[0044] 1. Extraction of DNA

[0045] Cut about 5mg of fish muscle tissue, shred it as much as possible, put it in a 1.5ml centrifuge tube, and place it at room temperature. After the ethanol is completely evaporated, use the cell / tissue genome kit of GENEray company to extract genomic DNA. .

[0046] 2. PCR amplification

[0047] The general primers of COI gene in Cyprinidae fish were used as PCR primers. The sequences of the upstream and downstream primers were: CypFCOI: tctcaaccaaccacaaagacattgg, CypRCOI: gacttctgggtggccaaagaatca. The total volume of the PCR reaction system was 50 μl, and a PCR kit was used for PCR amplification. The specific components are shown in Table 1, and the PCR reaction procedure is shown in Table 2.

[0048] 3. Agarose gel electrophoresis detection

[0049] Perform electrophoresis on the PCR product at a constant voltage of 5 V / cm, and stop the electrophoresis when the bromophenol blue moves to about 5 cm from the front of the agarose gel. The ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The present invention discloses a zacco platypus DNA barcode sequence and an application thereof, and belongs to the technical field of species identification. The zacco platypus DNA barcode sequenceis a zacco platypus COI gene. The DNA barcode sequence can be used as a standard detection sequence of zacco platypus DNA and is effective for identifying endemic species of zacco platypus.

Description

technical field [0001] The invention belongs to the technical field of species identification, and in particular relates to a DNA barcode sequence and an application thereof. Background technique [0002] Species identification has always been a crucial foundational step in the study of taxonomy and indeed almost all biological fields. Therefore, accurate identification and classification of species is particularly important. At present, researchers from various countries have carried out research projects on fish DNA barcoding in different geographic regions from lakes to oceans, and studies have shown that DNA barcoding is highly efficient and feasible in species identification. A large number of research results have shown that DNA barcodes marked with COI genes can accurately identify species of various animals, and COI genes can be selected as standard barcodes for various animal barcode databases. [0003] DNA barcode refers to a relatively short DNA fragment that ca...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/6888C12N15/11
CPCC12Q1/6888C12Q2600/166
Inventor 熊飞曹梦西王莹刘红艳文涵宇
Owner JIANGHAN UNIVERSITY
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com