Zacco platypus DNA barcode sequence and application thereof
A barcode and sequence technology, which is applied in the field of species identification, can solve the problems of lack of COI gene and difficulty in identification of the broadfin lapfish, and achieves the effect of simple method, few steps, and convenient comparison.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Examples
Embodiment 1
[0017] Five samples of broadfin carp from the Shaonuping section of the Xiangjiaba reservoir area in the lower reaches of the Jinsha River were taken for verification.
[0018] 1. Extraction of DNA
[0019] Cut about 5mg of fish muscle tissue, shred it as much as possible, put it in a 1.5ml centrifuge tube, and place it at room temperature. After the ethanol is completely evaporated, use the cell / tissue genome kit of GENEray company to extract genomic DNA. .
[0020] 2. PCR amplification
[0021] The general primers of COI gene in Cyprinidae fish were used as PCR primers. The sequences of the upstream and downstream primers were: CypFCOI: tctcaaccaaccacaaagacattgg, CypRCOI: gacttctgggtggccaaagaatca. The total volume of the PCR reaction system was 50 μl, and a PCR kit was used for PCR amplification. The specific components are shown in Table 1, and the PCR reaction procedure is shown in Table 2.
[0022] Table 1 PCR reaction system
[0023] reactive component Vol...
Embodiment 2
[0033] 1. Extraction of DNA
[0034] Cut about 5mg of fish muscle tissue, shred it as much as possible, put it in a 1.5ml centrifuge tube, and place it at room temperature. After the ethanol is completely evaporated, use the cell / tissue genome kit of GENEray company to extract genomic DNA. .
[0035] 2. PCR amplification
[0036] The general primers of COI gene in Cyprinidae fish were used as PCR primers. The sequences of the upstream and downstream primers were: CypFCOI: tctcaaccaaccacaaagacattgg, CypRCOI: gacttctgggtggccaaagaatca. The total volume of the PCR reaction system was 50 μl, and a PCR kit was used for PCR amplification. The specific components are shown in Table 1, and the PCR reaction procedure is shown in Table 2.
[0037] 3. Agarose gel electrophoresis detection
[0038] Perform electrophoresis on the PCR product at a constant voltage of 5 V / cm, and stop the electrophoresis when the bromophenol blue moves to about 5 cm from the front of the agarose gel. The ...
Embodiment 3
[0044] 1. Extraction of DNA
[0045] Cut about 5mg of fish muscle tissue, shred it as much as possible, put it in a 1.5ml centrifuge tube, and place it at room temperature. After the ethanol is completely evaporated, use the cell / tissue genome kit of GENEray company to extract genomic DNA. .
[0046] 2. PCR amplification
[0047] The general primers of COI gene in Cyprinidae fish were used as PCR primers. The sequences of the upstream and downstream primers were: CypFCOI: tctcaaccaaccacaaagacattgg, CypRCOI: gacttctgggtggccaaagaatca. The total volume of the PCR reaction system was 50 μl, and a PCR kit was used for PCR amplification. The specific components are shown in Table 1, and the PCR reaction procedure is shown in Table 2.
[0048] 3. Agarose gel electrophoresis detection
[0049] Perform electrophoresis on the PCR product at a constant voltage of 5 V / cm, and stop the electrophoresis when the bromophenol blue moves to about 5 cm from the front of the agarose gel. The ...
PUM

Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com