Unlock instant, AI-driven research and patent intelligence for your innovation.

A group of molecular markers linked to the content of (+)-catechin in tea tree and its application

A technology of catechins and tea trees, applied in the field of molecular genetics and breeding, can solve the problems of affecting the content of catechins and failing to find them

Active Publication Date: 2020-09-18
TEA RES INST GUANGDONG ACAD OF AGRI SCI
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0007] The discovery of molecular markers closely linked to the excellent traits of tea trees is the basis for molecular marker-assisted selection breeding of tea trees. However, due to the limitations of traditional QTL mapping research progress, it has not been possible to find SNP molecular markers that affect catechin content.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A group of molecular markers linked to the content of (+)-catechin in tea tree and its application
  • A group of molecular markers linked to the content of (+)-catechin in tea tree and its application
  • A group of molecular markers linked to the content of (+)-catechin in tea tree and its application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0079] 1. Experimental samples

[0080] Collected 191 tea tree materials located in the Guangdong Tea Tree Germplasm Resource Bank (Guangdong, Yingde, 113.3OE, 24.3ON), including 124 in Guangdong, 20 in Fujian, 15 in Guangxi, 9 in Zhejiang, 6 in Hunan, and 6 in Yunnan 1 copy in Jiangxi, 1 copy in Guizhou, and 1 copy in Taiwan. In addition, 8 descendants of Kenyan tea species and 1 descendant of Georgian species, the selected materials are widely representative.

[0081] The selected resources are randomly distributed in the resource pool. Single planting in double rows, each row 4m, row spacing 1.5m, plant spacing 35cm. The resource bank conducts routine water and fertilizer management. At the end of 2016, the resources were pruned and basal fertilizer was applied in deep pits, 4 tons of organic fertilizer, 0.75 tons of peanut bran and 10 catties of compound fertilizer per mu. After spring tea and summer tea in 2017, pruning and topdressing outside the roots, 30 catties of...

Embodiment 2

[0106] Verification of Example 2 SNP site

[0107] 1. Experimental method

[0108] The genotypes of SNP site 1 (Scaffold3614: 66549), SNP site 2 (Scaffold349: 3413816) and SNP site 3 (Scaffold1989: 2316385) were verified in another population containing 98 germplasms.

[0109] 1. Detect the (+)-catechin content of each sample. The specific detection method is the same as in Example 1.

[0110] 2. Use the SnaPShot technology platform to detect the genotypes of SNP site 1 (Scaffold3614: 66549), SNP site 2 (Scaffold349: 3413816) and SNP site 3 (Scaffold1989: 2316385) in each sample.

[0111] This method designs primers of different lengths for different mutation sites. After the SNaPshot reaction, the products are separated by electrophoresis, detected by five-color fluorescence, and analyzed by Gene mapper. Multiple SNP sites can be detected in one sequencing reaction. Using SNaPshot for fixed-point sequence analysis, its basic principle follows the dideoxy termination method...

Embodiment 3

[0164] Example 3 A kit for evaluating the content of tea tree (+)-catechin

[0165] 1. Composition

[0166] Its nucleotide sequence is as shown in SEQ ID NO: 2~3 The primer for detecting SNP site 1, its nucleotide sequence is as shown in SEQ ID NO: 5~6 The primer for detecting SNP site 2, its core The nucleotide sequence is as shown in SEQ ID NO: 8-9, primers for detecting SNP site 3, 2×Taq PCR Master Mix, ddH 2 O.

[0167] Wherein, SNP site 1 primer F: GATGACACAACCCTCATCTG (SEQ ID NO: 2);

[0168] SNP site 1 primer R: AATGTATGCCCGGTAAGGAC (SEQ ID NO: 3);

[0169] SNP site 2 primer F: TCTCTGCACTGTTGTCACTC (SEQ ID NO: 5);

[0170] SNP site 2 primer R: CACCACACTTTCTTAGAAGG (SEQ ID NO: 6);

[0171] SNP site 3 primer F: GATTTGACCTTCAACGTGGG (SEQ ID NO: 8);

[0172] SNP site 3 primer R: TGCAGCGTTTGTGTTTGCAG (SEQ ID NO: 9);

[0173] 2. How to use

[0174] (1) Extract the total DNA of tea tree shoots by the CTAB method, and ensure that the A260 / A280 of each DNA sample is betw...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a molecular marker linked to the content of tea tree (+)-catechin and application of the molecular marker. SNP molecular marker sites located on sites Scaffold 3614:66549, Scaffold 349:3413816 and Scaffold 1989:2316385 on a tea tree genome and related to the content of (+)-catechin are firstly found, and the SNP molecular marker sites are very significantly related to the content of (+)-catechin. A detection method for detecting each site is further established. One or a plurality of molecular markers can be used for evaluating the content of catechin of the tea tree for further used in high (+)-catechin tea tree resource selection and molecular breeding, and great research value is achieved.

Description

technical field [0001] The invention relates to the technical field of molecular genetic breeding, and more specifically relates to a group of molecular markers linked with tea tree (+)-catechin content and applications thereof. Background technique [0002] Tea (Camellia sinensis (L.) O.Kuntze) belongs to the tea group of the genus Camellia in the family Theaceae, originated in the southwestern region of China, and has a cultivation history of more than 5,000 years ago. Tea, coffee, and cocoa are known as the world's three major non-alcoholic beverages, which have important economic value and have an important impact on society and culture. [0003] The characteristic secondary metabolites catechins in tea shoots are the main factors affecting the taste of tea. Catechin compounds are derivatives of 2-phenylbenzopyran, belonging to flavan-3-ols in flavonoid compounds, accounting for 12% to 24% of the dry weight of tea leaves. According to the number of hydroxyl groups on t...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12Q1/6895C12N15/11
CPCC12Q1/6895C12Q2600/13C12Q2600/156C12Q2600/172
Inventor 方开星吴华玲李红建姜晓辉秦丹丹李波王秋霜潘晨东
Owner TEA RES INST GUANGDONG ACAD OF AGRI SCI