A group of molecular markers linked to the content of (+)-catechin in tea tree and its application
A technology of catechins and tea trees, applied in the field of molecular genetics and breeding, can solve the problems of affecting the content of catechins and failing to find them
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0079] 1. Experimental samples
[0080] Collected 191 tea tree materials located in the Guangdong Tea Tree Germplasm Resource Bank (Guangdong, Yingde, 113.3OE, 24.3ON), including 124 in Guangdong, 20 in Fujian, 15 in Guangxi, 9 in Zhejiang, 6 in Hunan, and 6 in Yunnan 1 copy in Jiangxi, 1 copy in Guizhou, and 1 copy in Taiwan. In addition, 8 descendants of Kenyan tea species and 1 descendant of Georgian species, the selected materials are widely representative.
[0081] The selected resources are randomly distributed in the resource pool. Single planting in double rows, each row 4m, row spacing 1.5m, plant spacing 35cm. The resource bank conducts routine water and fertilizer management. At the end of 2016, the resources were pruned and basal fertilizer was applied in deep pits, 4 tons of organic fertilizer, 0.75 tons of peanut bran and 10 catties of compound fertilizer per mu. After spring tea and summer tea in 2017, pruning and topdressing outside the roots, 30 catties of...
Embodiment 2
[0106] Verification of Example 2 SNP site
[0107] 1. Experimental method
[0108] The genotypes of SNP site 1 (Scaffold3614: 66549), SNP site 2 (Scaffold349: 3413816) and SNP site 3 (Scaffold1989: 2316385) were verified in another population containing 98 germplasms.
[0109] 1. Detect the (+)-catechin content of each sample. The specific detection method is the same as in Example 1.
[0110] 2. Use the SnaPShot technology platform to detect the genotypes of SNP site 1 (Scaffold3614: 66549), SNP site 2 (Scaffold349: 3413816) and SNP site 3 (Scaffold1989: 2316385) in each sample.
[0111] This method designs primers of different lengths for different mutation sites. After the SNaPshot reaction, the products are separated by electrophoresis, detected by five-color fluorescence, and analyzed by Gene mapper. Multiple SNP sites can be detected in one sequencing reaction. Using SNaPshot for fixed-point sequence analysis, its basic principle follows the dideoxy termination method...
Embodiment 3
[0164] Example 3 A kit for evaluating the content of tea tree (+)-catechin
[0165] 1. Composition
[0166] Its nucleotide sequence is as shown in SEQ ID NO: 2~3 The primer for detecting SNP site 1, its nucleotide sequence is as shown in SEQ ID NO: 5~6 The primer for detecting SNP site 2, its core The nucleotide sequence is as shown in SEQ ID NO: 8-9, primers for detecting SNP site 3, 2×Taq PCR Master Mix, ddH 2 O.
[0167] Wherein, SNP site 1 primer F: GATGACACAACCCTCATCTG (SEQ ID NO: 2);
[0168] SNP site 1 primer R: AATGTATGCCCGGTAAGGAC (SEQ ID NO: 3);
[0169] SNP site 2 primer F: TCTCTGCACTGTTGTCACTC (SEQ ID NO: 5);
[0170] SNP site 2 primer R: CACCACACTTTCTTAGAAGG (SEQ ID NO: 6);
[0171] SNP site 3 primer F: GATTTGACCTTCAACGTGGG (SEQ ID NO: 8);
[0172] SNP site 3 primer R: TGCAGCGTTTGTGTTTGCAG (SEQ ID NO: 9);
[0173] 2. How to use
[0174] (1) Extract the total DNA of tea tree shoots by the CTAB method, and ensure that the A260 / A280 of each DNA sample is betw...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


