Novel oncolytic virus, as well as preparation method and application thereof

An oncolytic virus, a new type of technology, is applied in the field of biomedicine to achieve the effect of enhancing killing ability, promoting value-added differentiation, and good application prospects

Active Publication Date: 2019-11-26
SHANGHAI PUBLIC HEALTH CLINICAL CENT
View PDF2 Cites 11 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

At present, there are few research reports on the application of AIF protein to induce tumor cell apoptosis at home and abroad.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Novel oncolytic virus, as well as preparation method and application thereof
  • Novel oncolytic virus, as well as preparation method and application thereof
  • Novel oncolytic virus, as well as preparation method and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0032] Example 1: Construction and expression verification of recombinant vaccinia virus rTV-AIF-GM-CSF

[0033] 1.1 Construction of pSC65 vector with human AIF-GM-CSF target gene

[0034] The DNA sequence of AIF-GM-CSF was artificially synthesized, and the T2A sequence was used to connect the two genes. The synthesized sequence is shown in SEQ ID NO: 1. The following primers were used to perform PCR amplification using the synthesized DNA sequence as a template. The primers for amplification are:

[0035] AIF-GM-CSF-F: GTACCAGGCCTAGTACTATGTTCCGGTGTGGAGGCCT

[0036] AIF-GM-CSF-R:AATAAGCTCGAAGTCGACTCACTCCTGGACTGGCTCCCAGCAG

[0037] PCR reaction program: pre-denaturation at 94°C for 5 minutes; denaturation at 98°C for 10 seconds, annealing at 58°C for 30 seconds, extension at 72°C for 2 minutes, and 30 cycles of reaction; full extension at 72°C for 10 minutes, and stop at 25°C.

[0038] Recovery of PCR products and clone construction: After amplification, the target gene wa...

Embodiment 2

[0058] Embodiment 2 Amplification of recombinant vaccinia virus rTV-AIF-GM-CSF

[0059] 1. Preparation of 143TK-cells: Spread the cells in a 24-well plate (2×10 5 cells / well), the cell density should reach 100% of the bottom area of ​​the 24-well plate when used;

[0060] 2. Dilute the virus: dilute the vaccinia virus liquid with the maintenance medium, starting from 1:100, make a 10-fold dilution, and the final volume is 1100 μL;

[0061] 3. Discard the complete medium in the 24-well plate, add virus dilution (500 μL / well), and make two duplicate wells. Incubate for about 48 hours at 37°C and 5% CO2, and determine the patching time according to the formation of virus plaques;

[0062] 3. To collect vaccinia virus: Discard 8 mL of medium in the dish, take 2 mL of maintenance medium to blow off the remaining cells, and collect in a 15 mL centrifuge tube;

[0063] 4. After freezing for 24 hours, freeze and thaw the harvested virus solution twice more, then conduct densi...

Embodiment 3

[0064] Titer determination of embodiment three recombinant vaccinia virus rTV-AIF-GM-CSF

[0065] 1.143 TK - Cell preparation: Cells were plated in 24-well plates (2×10 5 cells / well), the cell density should reach 100% of the bottom area of ​​the 24-well plate when used;

[0066] 2. To dilute the virus, dilute the vaccinia virus liquid with the maintenance medium, starting from 1:100, make a 10-fold dilution, and the final volume is 1100 μL;

[0067] 3. Discard the medium in the 24-well plate, add virus dilution (500 μL / well), and make two duplicate wells. 37°C 5% CO 2 Incubate for about 48 hours under certain conditions, and determine the patching time according to the formation of virus plaques;

[0068] 4. Spotting method: Prepare 8 mL of spotting medium containing 2×DMEM medium + 4% FBS + 2% PS and 8 mL of low-melting point agarose melted in a boiling water bath and placed in a 37°C water bath. Mix, then add X-gal to the mixture, the final concentration is 200 μg...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention discloses a novel oncolytic virus based on vaccinia virus Tiantan strain. The thymidine kinase (TK) region of the virus contains a coding sequence of AIF-GM-CSF as shown in SEQ ID NO.1.The oncolytic vaccinia virus which can efficiently expressing a human AIF-GM-CSF gene is prepared by effectively combining the tumor suppression effect of gene therapy and the oncolytic effect of viral therapy. While the oncolytic virus of the vaccinia virus Tiantan strain achieves the oncolytic effect to pyrolyze tumor cells, human AIF is massively expressed to cause apoptosis of a great number of infected tumor cells; and a great number of human GM-CSF can be expressed, and NK cells or DC cells can be recruited into the inside of a tumor to kill the tumor or effectively represent a tumor antigen, so that proliferation and differentiation of cytotoxicity t cells can be improved, and multiple anti-tumor effects can be achieved. Compared with simple gene therapy or virus therapy, the malignant tumor killing performance of the novel oncolytic virus is reinforced.

Description

technical field [0001] The invention belongs to the field of biomedical technology, and specifically relates to a novel oncolytic virus comprising a modified or transformed human apoptosis-inducing factor and a human neutrophil-macrophage colony-stimulating factor (AIF-GM-CSF) gene and the resulting The preparation method of the above-mentioned oncolytic virus and its application in anti-tumor. Background technique [0002] Due to the limited therapeutic effect and severe side effects of classic tumor treatment regimens in the treatment of advanced tumors, the field has been constantly exploring new anti-tumor treatment strategies. Oncolytic viruses selectively infect tumors locally, which can not only directly lyse tumor cells, but also induce different forms of cell death by acting on multiple cell pathways, and can also break the immune suppression of the tumor microenvironment to induce long-term tumor-specific immune response and reduce tumor resistance. When oncolyti...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Applications(China)
IPC IPC(8): C12N7/01C12N15/62C12N15/863A61K35/768A61P35/00A61P35/02C12R1/93
CPCA61K35/768A61P35/00A61P35/02C07K14/4703C07K14/535C12N7/00C12N15/86C12N2710/24021C12N2710/24032C12N2710/24043C12N2710/24051
Inventor 徐建青张晓燕丁相卿陈晔廖启彬
Owner SHANGHAI PUBLIC HEALTH CLINICAL CENT
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap