Method for quickly detecting zucchini yellow mosaic virus of siraitia grosvenorii
A technology of small zucchini and mosaic virus, which is applied in the direction of microbe-based methods, biochemical equipment and methods, and microbiological determination/inspection, and can solve the problems of complex operation of molecular hybridization technology, unreasonable primer design, and insufficient sensitivity of detection, etc. , to achieve the effect of increasing the risk of transmission, short detection cycle and good repeatability
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0047] 1) Design of detection primers
[0048] The detection primers were designed according to the conserved region of the nucleotide sequence of the ZYMV coat protein gene in GenBank, the forward primer zv1: CATGCCGAGGTATGGTTTGCTTCG, the reverse primer zv2: ACATCACGTGCAGTGTGCCGTTCA, the length of the expected specific product is 222bp.
[0049] 2) Extraction of total RNA from Luo Han Guo seedlings
[0050]Weigh 0.1g leaves and place them in a mortar, grind them into powder under liquid nitrogen, and quickly transfer them to a pre-cooled 1.5mL EP tube; add 600μL TrizoL lysate, mix quickly, and let stand at room temperature for 10min; add 200μL chloroform, quickly Mix well, place at room temperature for 10mim; 4°C, 10000rpm, 15min; transfer the supernatant to a new RNase-free EP tube, add isopropanol 0.6 times the volume of the supernatant, mix gently, and place at room temperature for 15min; Centrifuge at 12,000 rpm for 10 min at 4°C; discard the supernatant and wash twice w...
Embodiment 2
[0058] 1) Design of detection primers
[0059] The detection primers were designed according to the conserved region of the nucleotide sequence of the ZYMV coat protein gene in GenBank, the forward primer zv3: ATACATGCCGAGGTATGGTTTGCTTCG, the reverse primer zv4: GCAGTGTGCCGTTCAGTGTCTTCG, the length of the expected specific product is 216bp.
[0060] 2) Extraction of total RNA from Luo Han Guo seedlings
[0061] Weigh 0.1g leaves and place them in a mortar, grind them into powder under liquid nitrogen, and quickly transfer them to a pre-cooled 1.5mL EP tube; add 600μL TrizoL lysate, mix quickly, and let stand at room temperature for 10min; add 200μL chloroform, quickly Mix well, place at room temperature for 10mim; 4°C, 10000rpm, 15min; transfer the supernatant to a new RNase-free EP tube, add isopropanol 0.6 times the volume of the supernatant, mix gently, and place at room temperature for 15min; Centrifuge at 12,000 rpm for 10 min at 4°C; discard the supernatant and wash twi...
Embodiment 3
[0069] 1) Design of detection primers
[0070] The detection primers were designed according to the conserved region of the ZYMV coat protein gene nucleotide sequence in GenBank, the forward primer zv5: CATGCCGAGGTATGGTTTGCTTC, the reverse primer zv6: GCAGTGTGCCGTTCAGTGTCTTC, the length of the expected specific product was 213bp.
[0071] 2) Extraction of total RNA from Luo Han Guo seedlings
[0072] Weigh 0.1g leaves and place them in a mortar, grind them into powder under liquid nitrogen, and quickly transfer them to a pre-cooled 1.5mL EP tube; add 600μL TrizoL lysate, mix quickly, and let stand at room temperature for 10min; add 200μL chloroform, quickly Mix well, place at room temperature for 10mim; 4°C, 10000rpm, 15min; transfer the supernatant to a new RNase-free EP tube, add isopropanol 0.6 times the volume of the supernatant, mix gently, and place at room temperature for 15min; Centrifuge at 12,000 rpm for 10 min at 4°C; discard the supernatant and wash twice with 75%...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com



