Molecular marker for identifying genetic genders of collichthys lucidus and application thereof
A technology of molecular markers and thorn plums, which is applied in the determination/inspection of microorganisms, biochemical equipment and methods, DNA/RNA fragments, etc., can solve the problems that have not been reported, and achieve a wide range of applicable materials and fish body damage. Small, wide-ranging effect on materials
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0039] The applicant of the present invention took the spiny-headed plumfish caught in Sanduao, Ningde City, Fujian Province, China as a sample, constructed 12 groups of male and female spiny-headed plumfish genome resequencing data, and used the resequencing data to carry out genome-wide association analysis ( figure 1 ) results showed that the sex-significantly correlated regions were located on chromosomes 1, 2, 6, 7, 8, 11, 14, 17 and 22. Among them, chromosome 1 and chromosome 7 had the most significant correlation sites, concentrated in the near-end region of chromosome 7 and the front region of chromosome 1. Further in-depth comparative analysis of male and female genome resequencing data ( figure 2 ), and finally found a specific deletion of a sequence in the sex-significantly related region of chromosome 7 in the male spiny head scallion, and finally screened the specific deletion sequence in the male spiny head squid, which is shown in SEQID NO: 1 ( image 3 ).
...
Embodiment 2
[0043] The primer pairs of the present invention are used to carry out PCR amplification on the genomic DNA of the male and female spiny snails determined by anatomical examination, and the accuracy and specificity of the method of the present invention are verified by comparing the agarose gel electrophoresis patterns. The specific method steps are as follows:
[0044] Take 11 female and male adult fishes of spiny-headed plum for anatomical examination and identify 11 each, cut off part of the fin rays of spiny-headed plum, put them in the alcohol solution, and store them at -20°C for genome extraction; use phenol Genomic DNA was extracted by the chloroform method, and the obtained genomic DNA was uniformly diluted to 30ng / μL as a template for later use;
[0045] Primer F: 5'GGATCTTAAACTGTGTGCTCCATTC 3'; SEQ ID NO:2;
[0046] Primer R: 5'CAATACTGACCTGCTGATGTGTAAT 3'; SEQ ID NO:3.
[0047] Carry out PCR amplification reaction system with described primer: total reaction volu...
PUM

Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com