Single-site DNA methylation detection kit
A detection kit and methylation technology, applied in the field of DNA methylation detection kits based on strand replacement probes and loop-mediated amplification
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0033] A single site DNA methylation detection kit, based on strand replacement probes and loop-mediated amplification to achieve DNA methylation detection, select the E-Box site in the proximal promoter region of the human genome SLC22A2 gene Methylation level locus detection object. The E-Box site sequence is designed to the position where the stem-loop structure of the LAMP amplification product is complementary to the F chain. Since the methylated template and the unmethylated template are treated with bisulfite, the bases are different (non-methylated The cytosine C is converted to uracil U, and the methylated cytosine remains unchanged). After LAMP amplification, a stem-loop structure product with a C / T single-base difference is produced. The single-base difference causes the OSD to be opened. The efficiency of the probe is different and the fluorescence intensity is different. Therefore, the LAMP-OSD method can detect the degree of methylation at the E-Box site in terms...
Embodiment 2
[0048] 1. Materials and methods
[0049] 1.1 Primers and probes
[0050] This kit uses Primer Premier 5 software to design PCR primers. Bisulfite conversion sequence primers are designed by MethPrimer (http: / / www.urogene.org / cgi-bin / methprimer / methprimer.cgi), and LAMP primers are designed by PrimerExplorer V5( http: / / primerexplorer.jp / lampv5e / index.html) design. The primer and probe sequences are as follows: Internal primer:
[0051] FIP(TATCAAAACCCTAATCCAAATTCTTGTTGGTTGGAGAATGAGT),
[0052] BIP(TGGTTTATATTACGTTGGGTTTTGTACGCACCGCCAACTT),
[0053] External primer:
[0054] F3(TTAGTATGTATTTYGAYGGT),
[0055] B3(CAACCAAAAACTTAATATACTCC),
[0056] Chain replacement detection probe OSD-F chain:
[0057] 5′-6-FAM-TTCTTCAAAACCCTATAAAAAAAACACACATATTTAACC-Inverted dT-3′
[0058] Chain replacement detection probe OSD-Q chain:
[0059] 5'-GTTTTTTTTATAGGGTTTTGAAGAA-BHQ1-3').
[0060] All DNA sequences were synthesized by Shanghai Shenggong Biological Engineering Co., Ltd.
[0061] 1.2 Bisulfite conversi...
Embodiment 3
[0115] A total of 30 tissue samples from kidney cancer patients were tested and verified by the LAMP-OSD method of this kit. The test results are as follows: Hypomethylation ( <30%) 28 copies, the positive result of the test is in full agreement with the reported result.
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


