Single-site DNA methylation detection kit

A detection kit and methylation technology, applied in the field of DNA methylation detection kits based on strand replacement probes and loop-mediated amplification

Active Publication Date: 2020-02-14
ZHEJIANG UNIV
View PDF5 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, different technologies have their own advantages, but also have certain limitations, especially for the detection of site DNA methylation, there are still huge challenges

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Single-site DNA methylation detection kit
  • Single-site DNA methylation detection kit
  • Single-site DNA methylation detection kit

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0033] A single site DNA methylation detection kit, based on strand replacement probes and loop-mediated amplification to achieve DNA methylation detection, select the E-Box site in the proximal promoter region of the human genome SLC22A2 gene Methylation level locus detection object. The E-Box site sequence is designed to the position where the stem-loop structure of the LAMP amplification product is complementary to the F chain. Since the methylated template and the unmethylated template are treated with bisulfite, the bases are different (non-methylated The cytosine C is converted to uracil U, and the methylated cytosine remains unchanged). After LAMP amplification, a stem-loop structure product with a C / T single-base difference is produced. The single-base difference causes the OSD to be opened. The efficiency of the probe is different and the fluorescence intensity is different. Therefore, the LAMP-OSD method can detect the degree of methylation at the E-Box site in terms...

Embodiment 2

[0048] 1. Materials and methods

[0049] 1.1 Primers and probes

[0050] This kit uses Primer Premier 5 software to design PCR primers. Bisulfite conversion sequence primers are designed by MethPrimer (http: / / www.urogene.org / cgi-bin / methprimer / methprimer.cgi), and LAMP primers are designed by PrimerExplorer V5( http: / / primerexplorer.jp / lampv5e / index.html) design. The primer and probe sequences are as follows: Internal primer:

[0051] FIP(TATCAAAACCCTAATCCAAATTCTTGTTGGTTGGAGAATGAGT),

[0052] BIP(TGGTTTATATTACGTTGGGTTTTGTACGCACCGCCAACTT),

[0053] External primer:

[0054] F3(TTAGTATGTATTTYGAYGGT),

[0055] B3(CAACCAAAAACTTAATATACTCC),

[0056] Chain replacement detection probe OSD-F chain:

[0057] 5′-6-FAM-TTCTTCAAAACCCTATAAAAAAAACACACATATTTAACC-Inverted dT-3′

[0058] Chain replacement detection probe OSD-Q chain:

[0059] 5'-GTTTTTTTTATAGGGTTTTGAAGAA-BHQ1-3').

[0060] All DNA sequences were synthesized by Shanghai Shenggong Biological Engineering Co., Ltd.

[0061] 1.2 Bisulfite conversi...

Embodiment 3

[0115] A total of 30 tissue samples from kidney cancer patients were tested and verified by the LAMP-OSD method of this kit. The test results are as follows: Hypomethylation ( <30%) 28 copies, the positive result of the test is in full agreement with the reported result.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a single-site DNA methylation detection kit. The kit is composed of a loop-mediated amplification reaction solution, DNA polymerase, a primer probe mixed solution and a standardsubstance. According to the kit disclosed by the invention, LAMP amplification is carried out on DNA of a sample subjected to salt treatment by utilizing a specific primer, an amplification product of a gene containing a methylation site is identified by virtue of an OSD report probe chain replacement reaction, and the methylation level is simply, quickly and highly-sensitively detected. The kitdisclosed by the invention can be used for single-site DNA methylation detection (an E-Box site in a near-end promoter region of a human genome SLC22A2 gene is selected as a detection target). The kitdisclosed by the invention is a product which is low in sample requirement, short in detection time, low in diagnosis cost, simple to operate and suitable for popularization, and is one of the correct directions in which existing cancer diagnosis technologies can obtain major breakthroughs.

Description

Technical field [0001] The invention belongs to the field of biotechnology, and relates to a new technology for methylation detection of biological samples such as serum, urine and other major diseases such as tumors, and in particular to a DNA methylation detection kit based on strand replacement probes and loop-mediated amplification. It can provide early diagnosis of clinical tumors and other major diseases, and provide high-sensitivity biological sample markers as auxiliary judgment basis. Background technique [0002] According to World Health Organization (WHO) statistics, 10 million people in the world suffer from cancer every year, and about 60,000 people die from cancer, accounting for 12% of the global deaths. According to the ranking of the incidence of cancer and the incidence of top ten malignant tumors in my country provided by the Office of Cancer Prevention and Treatment of the Ministry of Health: There are about 2.2 million new cancer cases in China each year, an...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/6886C12Q1/6844C12N15/11
CPCC12Q1/6844C12Q1/6886C12Q2600/154C12Q2531/119
Inventor蔡圣徐鸣成余露山曾苏
OwnerZHEJIANG UNIV