Unlock instant, AI-driven research and patent intelligence for your innovation.

Herbicide dicamba degradation gene dicx1 and its application

A dicamba and herbicide technology, applied in the field of biodegradation, can solve the problems of inability to study target proteins, unclear degradation mechanism of dicamba, etc.

Active Publication Date: 2021-07-13
LONGPING BIOTECHNOLOGY (HAINAN) CO LTD
View PDF5 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

At present, the degradation mechanism of dicamba is not clear, and it is impossible to study the target protein

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Herbicide dicamba degradation gene dicx1 and its application
  • Herbicide dicamba degradation gene dicx1 and its application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0025] Example 1 Expression of dicX1 gene sequence in Escherichia coli in soil metagenome

[0026] 1. Experimental materials

[0027] Escherichia coli JM109: It is a commercial product of Beijing Quanshijin Company.

[0028] PCR Template DNA: Soil Metagenomic DNA

[0029] 2. Experimental method

[0030] 1. Design a pair of PCR-specific primers according to the metagenomic gene sequence obtained by sequencing:

[0031] dicX1-F: 5′ ACCACTAGTATGCCTTTCGTTTACAATGC 3′

[0032] dicX1-R: 5′ACCCATATGTCAGGCGGCTTCCACCCGCTG 3′

[0033] 2. Amplify the target gene sequence from the metagenomic DNA by PCR method.

[0034] Reaction conditions: 95°C for 10 min, 35 cycles of [95°C for 30 sec, 58°C for 30 sec, 72°C for 1.0 min], 72°C for 10 min.

[0035] 3. After the PCR product was recovered by gel, it was cloned on the vector pJET, named pJET-dicX1, and verified by sequencing; then the dicX1 gene containing cohesive ends and the pRAD1 vector containing the groEL promoter were obtained by...

Embodiment 2

[0040] Example 2 Catalytic Activity Experiment of the Recombinant Escherichia coli Engineering Strain Expressing dicX1

[0041] 1. Experimental materials

[0042] Recombinant engineering strain: the JM-dicX1 strain expressing the dicX1 gene obtained in Example 1

[0043] Control strain: the JM-D1 strain containing the empty plasmid described in Example 1.

[0044] 2. Experimental method

[0045] 1. Streak activation of the control strain and the recombinant engineering strain on the LB solid medium plate;

[0046] 2. Pick a single colony and inoculate it in liquid LB medium supplemented with corresponding antibiotics, and cultivate it at 37°C until the middle and late stages of the index;

[0047] 3. 4000rpm, 4min, centrifuge to collect the bacteria, resuspend and wash the bacteria twice with MSM medium;

[0048] 4. Resuspend the strain in 50mL MSM medium containing 500mg / L dicamba;

[0049] 5. Collect the bacteria at different time points such as 0h, 24h, 48h and 76h, an...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The present invention obtains a gene dicX1 that degrades the herbicide dicamba in the metagenome of a certain soil sample. The present invention constructs a recombinant vector containing the gene, and expresses it in prokaryotic host cell Escherichia coli. Experiments prove that the gene has the function of degrading the herbicide dicamba after being expressed in the prokaryotic host cell, and can be used for the cultivation of herbicide-resistant transgenic crops and the bioremediation of polluted soil.

Description

technical field [0001] The invention belongs to the technical field of biodegradation and relates to the function of dicX1 gene expression protein to degrade the herbicide dicamba. Background technique [0002] Herbicides refer to agents that use various mechanisms and methods to eliminate weeds. While herbicides cause harm to weeds, they will also damage crops, which may cause problems such as crop yield reduction, which greatly limits the use of herbicides. In order to solve this problem of reduced yield, more and more people began to pay attention to the use of genetically modified means to breed herbicide-resistant crops. [0003] Dicamba is a selective and systemic post-emergence auxin herbicide, belonging to the benzoic acid herbicide, which has a significant control effect on annual and perennial broad-leaved weeds. At present, the degradation mechanism of dicamba is not clear, and the target protein cannot be studied. Only some studies have been carried out on the...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/31C07K14/00C12N15/70B09C1/10C12N15/82
CPCB09C1/10C07K14/00C12N15/70C12N15/8274
Inventor 周正富林敏陆伟张维郭倩楠陈明
Owner LONGPING BIOTECHNOLOGY (HAINAN) CO LTD
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com