Coding sequence of Gnb2 gene and application of coding sequence of Gnb2 gene in constructing mouse model

A technology for coding sequences and genes, which is applied in the field of genetic engineering to achieve the effect of reducing density

Inactive Publication Date: 2020-03-24
NORTHEAST NORMAL UNIVERSITY
View PDF1 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, there is no report on the e...

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Coding sequence of Gnb2 gene and application of coding sequence of Gnb2 gene in constructing mouse model
  • Coding sequence of Gnb2 gene and application of coding sequence of Gnb2 gene in constructing mouse model
  • Coding sequence of Gnb2 gene and application of coding sequence of Gnb2 gene in constructing mouse model

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0050] Example 1 Construction of Gnb2 knockout mice

[0051] 1. Use CRIPSR / Cas9 technology to design guide RNA (gRNA) for the exon region of Gnb2 using online software (http: / / crispr.mit.edu / ), and select gRNA1 and exon 5 located in exon 2 Three gRNA sites were designed for gRNA2 of exon 7 and gRNA3 located in exon 7, wherein the nucleotide sequence of gRNA1 is shown in SEQ ID NO.3, specifically: ccagtggggcgaattcagatgag; the nucleotide sequence of gRNA2 is shown in SEQ ID NO. 4, specifically: tatagtctcaagacccgagaggg; the nucleotide sequence of gRNA3 is shown in SEQ ID NO.5: cgagtcggacatcaatgccgtgg. Gene editing of the exon region can effectively lead to changes in the coding sequence, resulting in changes or deletions of protein functions (Gnb2 exon and gRNA pattern diagrams refer to figure 1 ).

[0052] 2. The gRNA is obtained by overlapping PCR and in vitro reverse transcription. First synthesize DNA fragments for overlapping PCR (see figure 2 ), introduce the T7 promot...

Embodiment 2

[0066] Example 2 Detection of Gnb2 Gene Knockout Mice Knockout Efficiency

[0067] In order to confirm the gene knockout efficiency, the present invention extracted the brain protein of postnatal day 7 (P7) mice, and performed Western-Blot detection. The results showed that in Gnb2 + / - The expression of Gβ2 protein in mouse brain was reduced by about 50%, and in Gnb2 - / - The expression of Gβ2 protein could not be detected in mouse brain ( Figure 10 ). At the same time, the expression of Gβ1 protein was not significantly affected ( Figure 11 ). The above results indicated that in the Gnb2 gene knockout mice we constructed, the homozygous mice did not express Gβ2 protein. Depend on Figure 10 It can be seen that the results of Western-Blot showed that Gβ2 was not expressed in the mouse cortex protein of Gnb2 knockout mice, while the expression of Gβ1 was not affected. Depend on Figure 11 It can be seen that the expression level of Gnb2 mRNA in heterozygous knockout mice...

Embodiment 3

[0068] Example 3 General Appearance of Gnb2 Knockout Mice

[0069] Comparison of postnatal day 56 (P56) Gnb2 - / - with Gnb2 + / + There was no significant difference in the body shape and brain structure shape of the mice ( Figure 12 ). Within 8 weeks after birth, Gnb2 - / - with Gnb2 + / + The growth curves of mice were similar ( Figure 13 ). Body length of P56 mice ( Figure 14 ), brain weight ( Figure 15 ), brain length ( Figure 16 ) and brain width ( Figure 17 ) and other basic phenotypes, Gnb2 was not found - / - and Gnb2 + / + There are differences visible to the naked eye in mice.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention, which belongs to the technical field of gene engineering, provides a coding sequence of a Gnb2 gene and application of the coding sequence of the Gnb2 gene in constructing a mouse model. After the coding sequence of the Gnb2 gene is knocked out, development of neuron dendritic spines is influenced to cause reduction of the density of the dendritic spines. The density of cone neurondendritic spines is analyzed by a Golgi staining method; and the result shows that after the Gnb2 gene is knocked out, the number of dendritic spines on the bottom dendrite and the top dendrite is obviously reduced and the density of the dendritic spines in unit length is obviously reduced. The result indicates that after the coding sequence of the Gnb2 gene is knocked out, the density of the conoid neuron dendritic spines is influenced, so that the conoid neuron dendritic spines are obviously reduced and the thus the density of the dendritic spines is obviously reduced. Therefore, the codingsequence of a Gnb2 gene has the great significance in the research and analysis of dendritic spine development and function regulation.

Description

technical field [0001] The invention relates to the technical field of genetic engineering, in particular to a coding sequence of the Gnb2 gene and an application of the coding sequence of the Gnb2 gene in constructing a mouse model. Background technique [0002] G protein (guanine nucleotide-binding proteins) is a type of protein containing guanylic acid, also known as GTP binding protein, which exists on the inner side of the plasma membrane of the cell and is a type of signal transduction protein with GTP hydrolase activity. All kinds of G protein (Heterotrimeric Gprotein) are formed by the combination of α, β, and γ subunits. [0003] The prior art discloses that Gnb2, which encodes the β2 subunit of the heterotrimeric G protein complex, is a novel disease gene for familial sinus node dysfunction and atrioventricular conduction defects. In addition, the Gnb2 gene has multiple mutations in various blood diseases and tumors. However, there is no report about the effect o...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
IPC IPC(8): C12N15/12C07K14/47C12N15/90A01K67/027
CPCA01K67/0276A01K2217/075A01K2227/105A01K2267/03C07K14/4722C12N15/907
Inventor 朱筱娟何潇潇郭野郑耀武裴晴晴刘林贺子轩陆楠
Owner NORTHEAST NORMAL UNIVERSITY
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products