Coding sequence of Gnb2 gene and application of coding sequence of Gnb2 gene in constructing mouse model
A technology for coding sequences and genes, which is applied in the field of genetic engineering to achieve the effect of reducing density
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0050] Example 1 Construction of Gnb2 knockout mice
[0051] 1. Use CRIPSR / Cas9 technology to design guide RNA (gRNA) for the exon region of Gnb2 using online software (http: / / crispr.mit.edu / ), and select gRNA1 and exon 5 located in exon 2 Three gRNA sites were designed for gRNA2 of exon 7 and gRNA3 located in exon 7, wherein the nucleotide sequence of gRNA1 is shown in SEQ ID NO.3, specifically: ccagtggggcgaattcagatgag; the nucleotide sequence of gRNA2 is shown in SEQ ID NO. 4, specifically: tatagtctcaagacccgagaggg; the nucleotide sequence of gRNA3 is shown in SEQ ID NO.5: cgagtcggacatcaatgccgtgg. Gene editing of the exon region can effectively lead to changes in the coding sequence, resulting in changes or deletions of protein functions (Gnb2 exon and gRNA pattern diagrams refer to figure 1 ).
[0052] 2. The gRNA is obtained by overlapping PCR and in vitro reverse transcription. First synthesize DNA fragments for overlapping PCR (see figure 2 ), introduce the T7 promot...
Embodiment 2
[0066] Example 2 Detection of Gnb2 Gene Knockout Mice Knockout Efficiency
[0067] In order to confirm the gene knockout efficiency, the present invention extracted the brain protein of postnatal day 7 (P7) mice, and performed Western-Blot detection. The results showed that in Gnb2 + / - The expression of Gβ2 protein in mouse brain was reduced by about 50%, and in Gnb2 - / - The expression of Gβ2 protein could not be detected in mouse brain ( Figure 10 ). At the same time, the expression of Gβ1 protein was not significantly affected ( Figure 11 ). The above results indicated that in the Gnb2 gene knockout mice we constructed, the homozygous mice did not express Gβ2 protein. Depend on Figure 10 It can be seen that the results of Western-Blot showed that Gβ2 was not expressed in the mouse cortex protein of Gnb2 knockout mice, while the expression of Gβ1 was not affected. Depend on Figure 11 It can be seen that the expression level of Gnb2 mRNA in heterozygous knockout mice...
Embodiment 3
[0068] Example 3 General Appearance of Gnb2 Knockout Mice
[0069] Comparison of postnatal day 56 (P56) Gnb2 - / - with Gnb2 + / + There was no significant difference in the body shape and brain structure shape of the mice ( Figure 12 ). Within 8 weeks after birth, Gnb2 - / - with Gnb2 + / + The growth curves of mice were similar ( Figure 13 ). Body length of P56 mice ( Figure 14 ), brain weight ( Figure 15 ), brain length ( Figure 16 ) and brain width ( Figure 17 ) and other basic phenotypes, Gnb2 was not found - / - and Gnb2 + / + There are differences visible to the naked eye in mice.
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


