CRISPR/dCas9 vectors for improving expression level of gliotoxin biosynthetic gene and construction method and application of CRISPR/dCas9 vectors

A technology of gene expression level and biosynthesis, applied in the fields of biochemistry and molecular biology, to achieve the effect of increasing yield and promoting application

Active Publication Date: 2020-04-28
GUANGDONG INST OF MICROBIOLOGY GUANGDONG DETECTION CENT OF MICROBIOLOGY
View PDF6 Cites 11 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, there are few reports on the CRISPR/dCas9-VP64 system o

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • CRISPR/dCas9 vectors for improving expression level of gliotoxin biosynthetic gene and construction method and application of CRISPR/dCas9 vectors
  • CRISPR/dCas9 vectors for improving expression level of gliotoxin biosynthetic gene and construction method and application of CRISPR/dCas9 vectors
  • CRISPR/dCas9 vectors for improving expression level of gliotoxin biosynthetic gene and construction method and application of CRISPR/dCas9 vectors

Examples

Experimental program
Comparison scheme
Effect test

Example Embodiment

[0033] Example 1: Construction of transcriptional regulation vector targeting gliotoxin biosynthesis gene

[0034] Since gliotoxin has been verified to have strong anti-tumor activity, the production of gliotoxin compounds in Edgar FS110 is relatively low. The CRSISPR / dCas9-VP64 system has been confirmed to have the function of activating the target gene and increasing the expression level of the target gene.

[0035] Therefore, the inventors searched for the CRISPR / dCas9 target sequence on the promoter pG of the gliotoxin biosynthesis gene gliG gene, designed the gRNA sequence CATCAAATCCGCGGCGGAAATTG, based on the pGPD promoter sequence (shown in SEQ ID NO. 1) and the pG target sequence. The primers pGPD F (SEQ ID NO. 2) and pG R (SEQ ID NO. 3); using the artificially synthesized pGPD promoter sequence as a template, PCR amplification was performed with primers pGPD F and pG R to obtain fragment 1. Reverse complementary design of pG F is carried out according to the pG R sequence...

Example Embodiment

[0037] Example 2: pLX-sgRNA-pG recombinant vector and pCDNA-pGPD-dCas9-VP64-cbx recombinant vector were introduced into Edgar FS110 and analysis of the expression level of gliotoxin biosynthesis genes

[0038] The method of introducing foreign genes into the protoplasts of Edgar FS110 is as follows:

[0039] (1) Put the prepared protoplasts (1×10 8 / mL) (refer to the inventor’s patent number 201510540618.1 for the specific preparation method, and the name is: a patent for Edder bacteria FS110 protoplast and its preparation method and transformation method) and 3.0μg pLX-sgRNA-pG recombinant vector and pCDNA-pGPD -dCas9-VP64-cbx recombinant vector plasmids are mixed, put on ice for 5 minutes, then add 200μL volume fraction 30% PEG4000, place at 30℃ for 15min, then add 400μL PEG4000, place at 30℃ for 15min, then add 1.2mLW5 solution to stop the reaction Finally, add 4mL of WI buffer and place it in a 30℃ shaker for low-speed overnight culture;

[0040] (2) After cooling the melted TB3...

Example Embodiment

[0046] Example 3: Comparative analysis of the production of gliotoxin compounds of wild Edder bacteria FS110 and recombinant Edder bacteria FS110

[0047] The wild Edder bacteria FS110 and recombinant Edder bacteria FS110 were inoculated, cultured with YPD medium, and cultured at 28°C for 7 days. The fermentation broth of wild and recombinant Edgar bacteria FS110 was collected, extracted with ethyl acetate, and concentrated by rotary evaporation. HPLC (Shimadzu, Japan) and Agilent 6430 LC / MS were used to analyze crude ethyl acetate extracts of wild Edder bacteria FS110 and recombinant Edder bacteria FS110, and the new gliotoxin in wild Edder bacteria FS110 The compounds Dichomycytes A and Dichomycytes B were used as positive controls. C18 column (4.6×250mm) was used for analysis and detection. The detection conditions are: the eluent is increased from 30% methanol to 100% methanol within 50 minutes, and the flow rate is 1.0 mL / min. HPLC detection and analysis results show that...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention discloses CRISPR/dCas9 vectors for improving the expression level of a gliotoxin biosynthetic gene and a construction method and application of the CRISPR/dCas9 vectors. According to theinvention, the CRISPR/dCas9 is disclosed for the first time to carry out specific transcription regulation and control on the biosynthetic gene of Dichotomomyces cejpii gliotoxin; a pLX-sgRNA-pG recombinant vector and a pCDNA-pGPD-dCas9-VP64-cbx recombinant vector for improving the expression level of a gliotoxin biosynthetic gene are constructed; and a CRISPR/dCas9 specific transcription regulation and control system suitable for Dichotomomyces cejpii is established, so that transcription regulation and control of Dichotomomyces cejpii FS110 gliotoxin biosynthesis are promoted, and a molecular biological foundation is laid for acquiring more gliotoxin derivatives with remarkable biological activity.

Description

technical field [0001] The invention belongs to the technical field of biochemistry and molecular biology, and in particular relates to a CRISPR / dCas9 vector for improving the expression level of gliotoxin biosynthetic genes and its construction method and application. Background technique [0002] The deep-sea fungus Dichotomomyces cejpii FS110 is an ascomycete from the deep sea, which can produce a variety of secondary metabolites to adapt to the deep-sea environment. Gliotoxin is a class of diketopiperazine compounds with biological activities such as antibacterial, anti-tumor and anti-immunosuppression. More than 30 kinds of gliotoxin compounds and their derivatives have been excavated from E. ederia FS110 in the early stage , which also includes gliotoxin dimer compounds with rare structures. Most of the gliotoxin compounds have significant anti-tumor activity, and the gliotoxin compound derivative Plinabulin has been used in the clinical phase III treatment of non-sma...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
IPC IPC(8): C12N15/80C12N15/65C12N15/66C12N15/90C12N1/15C12R1/645
CPCC12N15/80C12N15/65C12N15/66C12N15/902
Inventor 叶伟章卫民刘珊孔亚丽刘桃妹朱牧孜李赛妮岑由飞许丽琼
Owner GUANGDONG INST OF MICROBIOLOGY GUANGDONG DETECTION CENT OF MICROBIOLOGY
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap