Check patentability & draft patents in minutes with Patsnap Eureka AI!

CRISPR/dCas9 vectors for improving expression level of gliotoxin biosynthetic gene and construction method and application of CRISPR/dCas9 vectors

A technology of gene expression level and biosynthesis, applied in the fields of biochemistry and molecular biology, to achieve the effect of increasing yield and promoting application

Active Publication Date: 2020-04-28
GUANGDONG INST OF MICROBIOLOGY GUANGDONG DETECTION CENT OF MICROBIOLOGY
View PDF6 Cites 11 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, there are few reports on the CRISPR / dCas9-VP64 system on the improvement of gene expression levels in filamentous fungi

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • CRISPR/dCas9 vectors for improving expression level of gliotoxin biosynthetic gene and construction method and application of CRISPR/dCas9 vectors
  • CRISPR/dCas9 vectors for improving expression level of gliotoxin biosynthetic gene and construction method and application of CRISPR/dCas9 vectors
  • CRISPR/dCas9 vectors for improving expression level of gliotoxin biosynthetic gene and construction method and application of CRISPR/dCas9 vectors

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0033] Example 1: Construction of transcriptional regulation vector targeting gliotoxin biosynthesis gene

[0034]Since gliotoxin has been verified to have strong anti-tumor activity, the yield of gliotoxin compounds in E. dermatella FS110 is relatively low. The CRSISPR / dCas9-VP64 system has been proven to activate the target gene and increase the expression level of the target gene.

[0035] Therefore, the inventors searched for the target sequence of CRISPR / dCas9 on the promoter pG of the gliotoxin biosynthesis gene gliG gene, designed the gRNA sequence CATCAAATCCGCGGCGGAAATTG, and designed it according to the pGPD promoter sequence (as shown in SEQ ID NO.1) and the pG target sequence Primers pGPD F (SEQ ID NO.2) and pG R (SEQ ID NO.3); using the artificially synthesized pGPD promoter sequence as a template, fragment 1 was obtained by PCR amplification using primers pGPD F and pG R. Design pGF by reverse complementation according to the sequence of pG R, whose sequence is s...

Embodiment 2

[0037] Example 2: Analysis of the expression level of pLX-sgRNA-pG recombinant vector and pCDNA-pGPD-dCas9-VP64-cbx recombinant vector into E. dermatophila FS110 and gliotoxin biosynthesis genes

[0038] The method of introducing exogenous gene into the protoplast of Eideria FS110 is as follows:

[0039] (1) Prepared protoplasts (1×10 8 / mL) (refer to the inventor's patent number 201510540618.1 for the specific preparation method, and the name is: a patent of Eedleia FS110 protoplast and its preparation method and transformation method) and 3.0 μg pLX-sgRNA-pG recombinant vector and pCDNA-pGPD - Mix the dCas9-VP64-cbx recombinant vector plasmid, place it on ice for 5 minutes, then add 200 μL of 30% PEG4000 by volume fraction, and place it at 30°C for 15 minutes, then add 400 μL PEG4000, place it at 30°C for 15 minutes, then add 1.2mL of W5 solution to stop the reaction , and finally add 4mL of WI buffer and place on a shaker at 30°C at low speed for overnight culture;

[004...

Embodiment 3

[0046] Embodiment 3: comparative analysis of the production of gliotoxins of wild Eedleia FS110 and recombinant Eedleiae FS110

[0047] Wild E. ederia FS110 and recombinant E. ederia FS110 were inoculated, cultured in YPD medium, and cultured at 28° C. for 7 days. The fermented broth of wild and recombinant E. ederia FS110 was collected, extracted with ethyl acetate, and concentrated by rotary evaporation. Using HPLC (Shimadzu, Japan) and Agilent 6430 LC / MS to analyze the ethyl acetate crude extracts of wild E. ederia FS110 and recombinant E. dermatella FS110, and the novel gliotoxins in wild E. ederia FS110 Compounds Dichomycytes A and Dichomycytes B served as positive controls. Analysis and detection were performed with a C18 column (4.6×250mm). The detection conditions are as follows: the eluent increases from 30% methanol to 100% methanol within 50 min, and the flow rate is 1.0 mL / min. The results of HPLC detection and analysis showed that the peaks corresponding to Dic...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses CRISPR / dCas9 vectors for improving the expression level of a gliotoxin biosynthetic gene and a construction method and application of the CRISPR / dCas9 vectors. According to theinvention, the CRISPR / dCas9 is disclosed for the first time to carry out specific transcription regulation and control on the biosynthetic gene of Dichotomomyces cejpii gliotoxin; a pLX-sgRNA-pG recombinant vector and a pCDNA-pGPD-dCas9-VP64-cbx recombinant vector for improving the expression level of a gliotoxin biosynthetic gene are constructed; and a CRISPR / dCas9 specific transcription regulation and control system suitable for Dichotomomyces cejpii is established, so that transcription regulation and control of Dichotomomyces cejpii FS110 gliotoxin biosynthesis are promoted, and a molecular biological foundation is laid for acquiring more gliotoxin derivatives with remarkable biological activity.

Description

technical field [0001] The invention belongs to the technical field of biochemistry and molecular biology, and in particular relates to a CRISPR / dCas9 vector for improving the expression level of gliotoxin biosynthetic genes and its construction method and application. Background technique [0002] The deep-sea fungus Dichotomomyces cejpii FS110 is an ascomycete from the deep sea, which can produce a variety of secondary metabolites to adapt to the deep-sea environment. Gliotoxin is a class of diketopiperazine compounds with biological activities such as antibacterial, anti-tumor and anti-immunosuppression. More than 30 kinds of gliotoxin compounds and their derivatives have been excavated from E. ederia FS110 in the early stage , which also includes gliotoxin dimer compounds with rare structures. Most of the gliotoxin compounds have significant anti-tumor activity, and the gliotoxin compound derivative Plinabulin has been used in the clinical phase III treatment of non-sma...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/80C12N15/65C12N15/66C12N15/90C12N1/15C12R1/645
CPCC12N15/80C12N15/65C12N15/66C12N15/902
Inventor 叶伟章卫民刘珊孔亚丽刘桃妹朱牧孜李赛妮岑由飞许丽琼
Owner GUANGDONG INST OF MICROBIOLOGY GUANGDONG DETECTION CENT OF MICROBIOLOGY
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More