CRISPR/dCas9 vectors for improving expression level of gliotoxin biosynthetic gene and construction method and application of CRISPR/dCas9 vectors
A technology of gene expression level and biosynthesis, applied in the fields of biochemistry and molecular biology, to achieve the effect of increasing yield and promoting application
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0033] Example 1: Construction of transcriptional regulation vector targeting gliotoxin biosynthesis gene
[0034]Since gliotoxin has been verified to have strong anti-tumor activity, the yield of gliotoxin compounds in E. dermatella FS110 is relatively low. The CRSISPR / dCas9-VP64 system has been proven to activate the target gene and increase the expression level of the target gene.
[0035] Therefore, the inventors searched for the target sequence of CRISPR / dCas9 on the promoter pG of the gliotoxin biosynthesis gene gliG gene, designed the gRNA sequence CATCAAATCCGCGGCGGAAATTG, and designed it according to the pGPD promoter sequence (as shown in SEQ ID NO.1) and the pG target sequence Primers pGPD F (SEQ ID NO.2) and pG R (SEQ ID NO.3); using the artificially synthesized pGPD promoter sequence as a template, fragment 1 was obtained by PCR amplification using primers pGPD F and pG R. Design pGF by reverse complementation according to the sequence of pG R, whose sequence is s...
Embodiment 2
[0037] Example 2: Analysis of the expression level of pLX-sgRNA-pG recombinant vector and pCDNA-pGPD-dCas9-VP64-cbx recombinant vector into E. dermatophila FS110 and gliotoxin biosynthesis genes
[0038] The method of introducing exogenous gene into the protoplast of Eideria FS110 is as follows:
[0039] (1) Prepared protoplasts (1×10 8 / mL) (refer to the inventor's patent number 201510540618.1 for the specific preparation method, and the name is: a patent of Eedleia FS110 protoplast and its preparation method and transformation method) and 3.0 μg pLX-sgRNA-pG recombinant vector and pCDNA-pGPD - Mix the dCas9-VP64-cbx recombinant vector plasmid, place it on ice for 5 minutes, then add 200 μL of 30% PEG4000 by volume fraction, and place it at 30°C for 15 minutes, then add 400 μL PEG4000, place it at 30°C for 15 minutes, then add 1.2mL of W5 solution to stop the reaction , and finally add 4mL of WI buffer and place on a shaker at 30°C at low speed for overnight culture;
[004...
Embodiment 3
[0046] Embodiment 3: comparative analysis of the production of gliotoxins of wild Eedleia FS110 and recombinant Eedleiae FS110
[0047] Wild E. ederia FS110 and recombinant E. ederia FS110 were inoculated, cultured in YPD medium, and cultured at 28° C. for 7 days. The fermented broth of wild and recombinant E. ederia FS110 was collected, extracted with ethyl acetate, and concentrated by rotary evaporation. Using HPLC (Shimadzu, Japan) and Agilent 6430 LC / MS to analyze the ethyl acetate crude extracts of wild E. ederia FS110 and recombinant E. dermatella FS110, and the novel gliotoxins in wild E. ederia FS110 Compounds Dichomycytes A and Dichomycytes B served as positive controls. Analysis and detection were performed with a C18 column (4.6×250mm). The detection conditions are as follows: the eluent increases from 30% methanol to 100% methanol within 50 min, and the flow rate is 1.0 mL / min. The results of HPLC detection and analysis showed that the peaks corresponding to Dic...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com



