Application of duck-derived innate immunomodulatory protein DDX3X

A technology of innate immunity and regulation of proteins, applied in the fields of biotechnology and immunology, can solve the problems of innate immune response, the expression of ISG downstream of interferon in the signal transduction process and the regulation mechanism is not very clear, and achieve the effect of reducing activity.

Pending Publication Date: 2020-05-08
INST OF ANIMAL SCI & VETERINARY HUBEI ACADEMY OF AGRI SCI
View PDF1 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the innate immune response, signal transduction process and the expression and regulation mechanism of interferon downstream ISG in ducks are still not very clear.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of duck-derived innate immunomodulatory protein DDX3X
  • Application of duck-derived innate immunomodulatory protein DDX3X
  • Application of duck-derived innate immunomodulatory protein DDX3X

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0017] Changes in DDX3X transcript level after virus infection in Example 1

[0018] DTMUV infected DEF cells. The cells were harvested at 24h and 48h after infection, and the total RNA was extracted. After reverse transcription, fluorescent quantitative PCR was performed to detect the mRNA level of duDDX3X. The specific operation is as follows, the result of the mRNA level of duDDX3X is as follows figure 1 As shown, the results showed that the mRNA transcript level of duDDX3X was up-regulated after DTMUV infection.

[0019] Both DTMUV and DEF cell lines are preserved by our laboratory.

[0020] Fluorescent quantitative PCR primers:

[0021] Target gene duDDX3X

[0022] Upstream primer duDDX3X-F: ATACTATGCCACCGAAAG

[0023] Downstream primer duDDX3X-R:GAACCTACTCTGCCAACA

[0024] GAPDH

[0025] Upstream primer qGAPDH-f:ATGAGAAGTATGACAAGTCC

[0026] Downstream primer qGAPDH-r: ACTGTCTTCGTGTGTGGCT

[0027] Fluorescent quantitative PCR method to detect the expression of th...

Embodiment 2

[0034] Example 2 Cloning of duck-derived DDX3X and construction of eukaryotic expression vector pCAGGS-duDDX3X-flag

[0035] (1) Take soybean-sized duck spleen tissue, grind it, and use the TRIZOL method to extract total RNA according to the operation step (1) in Example 1.

[0036](2) Reverse transcribing the RNA extracted in step (1) into cDNA, using a commercial kit, referring to the instructions of the Roche reverse transcription kit, and performing the specific operation according to the operation step (2) in Example 1.

[0037] (3) According to the predicted full-length cDNA sequence of the duck-derived DDX3X gene, select KpnI and XhoI double restriction sites to design primers, wherein the upstream primer is duDDX3X-f: 5`-GCGGTACCATGAGTCATGTGGCGGTGG-3`; the downstream primer is duDDX3X-r: 5`-GCCTCGAGTCAGTTGCCCCACCAGTCA-3`. The spleen cDNA prepared in step (2) was used as a template for PCR amplification, and the size of the specific amplification product was about 2000...

Embodiment 3

[0038] Example 3 Effect of DDX3X on IFN-β Promoter Activity

[0039] Through the luciferase detection system, DEF cells were co-transfected with pduDDX3X-flag and the luciferase reporter plasmid pGL-IFNB-Luc (constructed in the laboratory, refer to Example 2 for specific methods) containing the IFN-β promoter. After 24 hours, poly(I:C) was used to stimulate, and the luciferase activation was detected after 16 hours of stimulation. The specific operation process is as follows, and the results are as follows Figure 4 shown. in Figure 4 A bar graph shows that the activation of IFN-β promoter is dose-dependent with duDDX3X, indicating that overexpression of DDX3X can activate the activation of IFN-β promoter; NF-κB and IRF1 are two important transcription factors that regulate the expression of IFN-β factor, Figure 4 The histograms of B and 4C show that duDDX3X induces the expression of IFN-β by activating NF-κB and IRF1. The specific operation steps are as follows:

[004...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention belongs to the field of biotechnology and immunology, and particularly relates to a duck-derived innate immunomodulatory protein DDX3X for regulating and controlling an innate immune signal pathway in duck embryo fibroblasts (DEF), participating in antiviral reaction and playing a role in duck antiviral infection. It is proved in the DEF that overexpression of duck-derived DDX3X caninduce generation of duck I-type interferon by activating transcription factors including IRF1 and Nf-kappa B; after the background expression of DDX3X is interfered, the activity of poly(I: C) and DTMUV induced I-type interferon is also obviously reduced; and the overexpression of DDX3X can be used for remarkably inhibiting the proliferation of the DTMUV (Duck tembusu virus). The invention further discloses that the duck-derived DDX3X is expected to become a novel target for treating duck inflammatory diseases, and can be applied to the preparation of drugs with the effect of inhibiting DTMUVproliferation; the duck-derived DDX3X can also be used as an immunomodulator for duck virus diseases.

Description

technical field [0001] The invention belongs to the fields of biotechnology and immunology, and in particular relates to the application of duck-derived natural immunoregulatory protein DDX3X. Background technique [0002] Duck is an important economic animal in my country, and the number of ducks raised in my country ranks first in the world. However, compared with other mammals, the research on its natural immune system started relatively late. Studies have shown that poultry's natural immune system is specific, for example, ducks have an intact RIG-I receptor, which has never given it an advantage in fighting viral infections over chickens without RIG-I receptors. [0003] The antiviral response mediated by intracellular antiviral factors is the host's first line of defense against viral infection. Pattern recognition receptors (PRRs) are the first to recognize pathogen-associated molecular patterns (PAMPs) and initiate the host's immune response. natural immune respons...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Applications(China)
IPC IPC(8): A61K38/17A61P37/02A61P31/12
CPCA61K38/1703A61P37/02A61P31/12
Inventor 张蓉蓉王红琳卢琴张腾飞温国元罗青平张文婷商雨汪宏才罗玲邵华斌
Owner INST OF ANIMAL SCI & VETERINARY HUBEI ACADEMY OF AGRI SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap