Application of duck-derived innate immunomodulatory protein DDX3X
A technology of innate immunity and regulation of proteins, applied in the fields of biotechnology and immunology, can solve the problems of innate immune response, the expression of ISG downstream of interferon in the signal transduction process and the regulation mechanism is not very clear, and achieve the effect of reducing activity.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0017] Changes in DDX3X transcript level after virus infection in Example 1
[0018] DTMUV infected DEF cells. The cells were harvested at 24h and 48h after infection, and the total RNA was extracted. After reverse transcription, fluorescent quantitative PCR was performed to detect the mRNA level of duDDX3X. The specific operation is as follows, the result of the mRNA level of duDDX3X is as follows figure 1 As shown, the results showed that the mRNA transcript level of duDDX3X was up-regulated after DTMUV infection.
[0019] Both DTMUV and DEF cell lines are preserved by our laboratory.
[0020] Fluorescent quantitative PCR primers:
[0021] Target gene duDDX3X
[0022] Upstream primer duDDX3X-F: ATACTATGCCACCGAAAG
[0023] Downstream primer duDDX3X-R:GAACCTACTCTGCCAACA
[0024] GAPDH
[0025] Upstream primer qGAPDH-f:ATGAGAAGTATGACAAGTCC
[0026] Downstream primer qGAPDH-r: ACTGTCTTCGTGTGTGGCT
[0027] Fluorescent quantitative PCR method to detect the expression of th...
Embodiment 2
[0034] Example 2 Cloning of duck-derived DDX3X and construction of eukaryotic expression vector pCAGGS-duDDX3X-flag
[0035] (1) Take soybean-sized duck spleen tissue, grind it, and use the TRIZOL method to extract total RNA according to the operation step (1) in Example 1.
[0036](2) Reverse transcribing the RNA extracted in step (1) into cDNA, using a commercial kit, referring to the instructions of the Roche reverse transcription kit, and performing the specific operation according to the operation step (2) in Example 1.
[0037] (3) According to the predicted full-length cDNA sequence of the duck-derived DDX3X gene, select KpnI and XhoI double restriction sites to design primers, wherein the upstream primer is duDDX3X-f: 5`-GCGGTACCATGAGTCATGTGGCGGTGG-3`; the downstream primer is duDDX3X-r: 5`-GCCTCGAGTCAGTTGCCCCACCAGTCA-3`. The spleen cDNA prepared in step (2) was used as a template for PCR amplification, and the size of the specific amplification product was about 2000...
Embodiment 3
[0038] Example 3 Effect of DDX3X on IFN-β Promoter Activity
[0039] Through the luciferase detection system, DEF cells were co-transfected with pduDDX3X-flag and the luciferase reporter plasmid pGL-IFNB-Luc (constructed in the laboratory, refer to Example 2 for specific methods) containing the IFN-β promoter. After 24 hours, poly(I:C) was used to stimulate, and the luciferase activation was detected after 16 hours of stimulation. The specific operation process is as follows, and the results are as follows Figure 4 shown. in Figure 4 A bar graph shows that the activation of IFN-β promoter is dose-dependent with duDDX3X, indicating that overexpression of DDX3X can activate the activation of IFN-β promoter; NF-κB and IRF1 are two important transcription factors that regulate the expression of IFN-β factor, Figure 4 The histograms of B and 4C show that duDDX3X induces the expression of IFN-β by activating NF-κB and IRF1. The specific operation steps are as follows:
[004...
PUM

Abstract
Description
Claims
Application Information

- Generate Ideas
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com