A method and kit for simultaneously constructing sequencing libraries for dna and rna
A sequencing library and kit technology, applied in biochemical equipment and methods, chemical libraries, combinatorial chemistry, etc., can solve the problems of incomplete inactivation of transposases, low interruption efficiency, quality and speed of library construction, etc.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0066] Embodiment 1: the acquisition of mutant Tn5 transposase
[0067] The preparation method of the mutant Tn5 transposase whose amino acid sequence is shown in SEQ ID NO.1 comprises the following steps: Utilize the method of gene synthesis to synthesize the primer sequence comprising the site to be mutated and the substituted base as follows:
[0068] D24-f: CGGCGCTGGGTGAGCCTCGCCGTA
[0069] D24-r: TACGGCGAGGCTCACCCCAGCGCCG
[0070] A97-f: GCCATTGAGGAAACCACCT;
[0071] A97-r: AGGTGGTTTCCTCAATGGC;
[0072] K160-f: TGCGGATGAAAGGGAGAGTGGCAA
[0073] K160-r: TTGCCACTCTCCCTTTCATCCGC
[0074] C326-f: CGGATCGACGAGTTCCATA;
[0075] C326-r: TATGGAACTCGTCGATCCG;
[0076] Phanta Max Super-Fidelity DNA Polymerase (produced by Nanjing Nuoweizan Biotechnology Co., Ltd., Vazyme, product number P505) was used as the DNA polymerase. The amplification conditions were 95°C for 30s; 95°C for 15s; 60°C for 15s; 72°C for 30s-3min; 72°C for 5min; a total of 30 cycles. After amplification,...
Embodiment 2
[0078]Example 2: DNA / RNA rapid common library construction based on mutant Tn5 transposase
[0079] The core of the present invention lies in the rapid joint library construction of DNA / RNA. The reverse transcriptase used in this example is HiScript III Reverse Transcriptase (Product No. R302) of Nanjing Novizan Biotechnology Co., Ltd.; the reverse transcription reaction buffer used is Nanjing The buffer solution attached to HiScript III Reverse Transcriptase from Novizyme Biotechnology Co., Ltd.; the reverse transcription primer used is Oligo(dT) 20 Mixture of VN and random primers; Tn5 transposase is the mutant of D24E, D97E, K160R and E326D simultaneous mutation, ie: TTE-plus. The breaking buffer is the TTBL component in the TruePrep DNA library Prep Kit V2 for Illumina kit of Nanjing Nuoweizan Biotechnology Co., Ltd., that is, TruePrep Tagment Buffer L; breaking stop buffer 5×TS-plus, containing: 2.5% BSA, 1% Tween-20, 0.5% SDS, 25mM DTT; RNA purification magnetic beads a...
Embodiment 3
[0145] Example 3: DNA / RNA rapid common library construction based on mutant Tn5 transposase without intermediate purification
[0146] The core of the present invention lies in the rapid joint library construction of DNA / RNA. The reverse transcriptase used in this example is HiScript III Reverse Transcriptase (Product No. R302) of Nanjing Novizan Biotechnology Co., Ltd.; the reverse transcription reaction buffer used is Nanjing The buffer solution attached to HiScript III Reverse Transcriptase from Novizyme Biotechnology Co., Ltd.; the reverse transcription primer used is Oligo(dT) 20 VN; Tn5 transposase is a mutant of simultaneous mutation of D24E, D97E, K160R and E326D, namely: TTE-plus. The breaking buffer is the TTBL component in the TruePrepDNAlibrary Prep Kit V2 for Illumina kit of Nanjing Nuoweizan Biotechnology Co., Ltd., that is, TruePrep TagmentBuffer L; breaking stop buffer 5×TS-plus, containing: 2.5% BSA, 1 % Tween-20, 0.5% SDS, 25mMDTT. DNA purification magnetic...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com