Breeding method for shortening growth period of rice
A rice growth period and growth period technology, applied in the field of rice biotechnology breeding, can solve the problem of less fixed-point insertion of the genome
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0035] Example 1. Design and activity detection of sgRNA
[0036] The upstream regulatory sequence (SEQ ID NO: 1) of the early flowering gene OsUSP1 is entered into the URL as http: / / crispr.hzau.edu.cn / CRISPR / The online analysis software CRISPR-P 1.0 can design the target sequence online.
[0037] Select 19 candidate targets in the sequence of SEQ ID NO: 1 (Table 1), and perform enzyme digestion verification in vitro using conventional steps to detect the activity of sgRNA. The results of enzyme digestion electrophoresis are as follows: figure 1 shown.
[0038] In vitro digestion verification includes (1) design of primers for gRNA transcription template amplification (Table 2); (2) PCR amplification of gRNA transcription template using the PCR mixture in Table 3 and the PCR amplification cycle in Table 4; (3) gRNA transcription Template recovery and purification; PCR amplification to obtain a 123bp fragment, the PCR product was purified with Omega D6492-1, and 6 times ...
Embodiment 2
[0053] Example 2. Construction of homologous recombination transformation vector
[0054] The 35S enhancer (SEQ ID NO: 25) was used as the enhancer for site-directed insertion, and about 750 bp of the upstream and downstream sequences of the target site were selected as the homologous recombination arm, and the CaMV35S promoter was inserted in the middle to construct PTG2-R001S07-35EB, and the gRNA was introduced into the pRE01 vector to construct pRE01-R001S07( Figure 4 ). When R001S07 is used as the target, the sequences of the homologous recombination arms are SEQ ID NO: 26 and 27; when R001S06 or R001S13 is used as the target, the nucleotide sequences of the homologous recombination arms are respectively SEQ ID NO: 28 and 29, or SEQ ID NO:30 and 31. PTG2-R001S07-35EB is modified on the basis of pCAMBIA-1300 commercial vector, adding LacZ promoter and virG Agrobacterium infection gene in the carrier element region, and adding another LB to the original LB of the T-DNA re...
Embodiment 3
[0055] Example 3. Transformation to obtain transgenic rice
[0056] The vectors pRE01-R001S07 and PTG2-R001S07-35EB were respectively transformed into Agrobacterium EHA105 to obtain two strains A and B. The double strains A and B were shaken separately to the OD value suitable for Agrobacterium infection, and the volume ratio of the bacteria to the liquid was 1:10 to infect the rice callus, co-cultivate, screen, and differentiate. After the obtained transformed seedlings are hardened, the transformed seedlings are transplanted to the field. Leaves were taken from the transformed seedlings, DNA was extracted, and identified by PCR.
[0057] In this test, two pairs of primers were used for PCR detection of transformed seedlings, and the two pairs of primers were respectively:
[0058] CT01-F0: CTGGTTTATGCTAGGCCATAGCAC (SEQ ID NO: 32)
[0059] 35S-R1: ATCACATCAATCCACTTGCTTTGAA (SEQ ID NO: 33)
[0060] The length of the amplified fragment is 1641bp.
[0061] R001F01-F1: ctgct...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More