ShRNA of CXCR4 gene and application of shRNA

A gene and expression vector technology, applied to the shRNA of the CXCR4 gene and its application fields, can solve problems such as the difficulty of human T cells

Inactive Publication Date: 2020-06-05
GUANGZHOU BIO GENE TECH CO LTD
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

At present, gene editing technology has been applied to genome editing of many types of cells, but it is still difficult for human T cells

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • ShRNA of CXCR4 gene and application of shRNA
  • ShRNA of CXCR4 gene and application of shRNA
  • ShRNA of CXCR4 gene and application of shRNA

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0078] siRNA and shRNA sequence design of embodiment 1 CXCR4 gene

[0079] The full-length mRNA sequence of the CXCR4 gene published by GenBank (NM_003467.2) was analyzed, the specific mRNA was obtained by Blast comparison, and the siRNA of CXCR4 mRNA was designed. The target position of each siRNA was as follows: figure 1 The specific sequence information is shown in Table 1.

[0080] Table 1 6 specific siRNAs of CXCR4 gene

[0081] serial number target nucleotide sequence target position SEQ ID NO:1 gcaaggcagtccatgtcatct 421~441 SEQ ID NO:2 ggatcagcatcgactccttca 868~888 SEQ ID NO:3 gcacatcatggttggccttat 701~721 SEQ ID NO:4 agataactacaccgaggaaat 122~142 SEQ ID NO:5 cctgttcttaagacgtgattt 1512~1532 SEQ ID NO:6 tcctgtcctgctattgcatta 739~759

[0082] According to the siRNA sequence, design the corresponding shRNA, the shRNA includes the sense strand (S) and the antisense strand (A), the shRNA sequence is composed...

Embodiment 2

[0086] The construction of the shRNA lentiviral expression vector of embodiment 2 CXCR4 gene

[0087] The pCHD vector was double-enzymatically digested with XhoI / EcoRV, and recovered by gel cutting; primer annealing was completed by designing specific primers based on shRNA; the shRNA and the recovered vector were recombined to form circular fragments, and transformed into the prepared bacterial competent cells , select a single clone colony for sequencing identification, and the correct clone is the successful construction of the shRNA silencing vector.

[0088] Specific steps are as follows:

[0089] (1) Double enzyme digestion of the vector

[0090] ① Cultivate the cloning strain containing pCDH empty vector overnight, take 5mL of fresh bacterial liquid and use QIAGEN plasmid extraction kit to extract the plasmid;

[0091] ②Take 2 μg of the extracted pCDH, and digest it with the corresponding restriction endonuclease at 37°C for about 1 hour. The enzyme digestion system i...

Embodiment 3

[0112] Example 3 lentiviral packaging

[0113] The lentiviral vector constructed in Example 2 was packaged with lentivirus, using a four-plasmid system, and the specific steps were as follows:

[0114] (1) The four-plasmid system includes gag / pol, Rev, VSV-G and lentiviral vector pCDH-shCXCR4-1-6 or negative control plasmids required for packaging lentiviral vectors. Add the above plasmids to a certain volume of serum-free DMEM In the culture medium, place it for 15 minutes after mixing;

[0115] (2) Add the above mixture into a T75 culture flask lined with 293T cells, mix gently, and transiently transfect 293T cells, at 37°C, 5% CO 2 Cultivate in a cell incubator for 6 hours;

[0116] (3) Replace the fresh medium after 6 hours, continue the culture, and add 10 mM sodium butyrate solution, and collect the culture supernatant after 72 hours for lentivirus purification and detection.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides shRNA of a CXCR4 gene and an application of the shRNA. The shRNA comprises siRNA of the CXCR4 gene and an inverted repeat sequence of the siRNA. According to the invention, a constructed slow virus vector realizes hereditary silencing to the CXCR4 gene in a T cell; the expression level of the CXCR4 gene in an edited T cell is significantly reduced; and a novel method and thought are provided for treatment of tumors and immune diseases.

Description

technical field [0001] The invention belongs to the technical field of genetic engineering, and relates to shRNA of CXCR4 gene and application thereof. Background technique [0002] As the main immune cells of the human body, T cells play an important role in regulating the immune system. T cells are the main target of human immunodeficiency virus (HIV). The virus mediates apoptosis and induces autoimmune responses, resulting in a decrease in the number of T cells, causing loss of cellular immunity, humoral immune response, and acquired immunodeficiency syndrome. HIV enters host cells through the binding of viral envelope protein to CCR5 or C-X-C motif chemokine receptor 4 (CXCR4) of CD4+ T cells. In most cases, HIV enters host cells through CCR5, triggering primary infection; at a later stage of infection, mutations in the envelope protein make the virus tropistic to CXCR4. [0003] It is feasible to use gene editing technology to treat HIV. Knocking out the CCR5 gene in...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N15/113C12N15/867C12N7/01C12N5/10A61K31/713A61P35/00A61P37/04
CPCA61K31/713A61P35/00A61P37/04C07K14/7158C12N7/00C12N15/113C12N15/86C12N2310/14C12N2310/531C12N2320/30C12N2740/15021C12N2740/15043
Inventor李光超罗敏丁雯
OwnerGUANGZHOU BIO GENE TECH CO LTD