Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Absolute quantitative PCR method for rapidly determining titer of ascoviruses

An absolute quantitative, virus titer technology, applied in biochemical equipment and methods, microbial determination/inspection, resistance to vector-borne diseases, etc. and other problems, to achieve the stability of experimental results, improve detection efficiency, and reduce time-consuming effects.

Active Publication Date: 2020-06-05
HUNAN AGRICULTURAL UNIV
View PDF2 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the calculation of cell staining results is easily affected by the staining time, the concentration of the staining solution, etc., and the method has a large workload, requiring staining in a short period of time and calculating the staining rates of hundreds of groups of cells at different dilutions. The counting process is complicated and time-consuming and labor-intensive. With this method, the experiment time is longer, and the overall requirements for the experimental environment are higher.
[0007] In summary, from the research and utilization of vesicle virus, due to the obvious defects of existing virus titer detection methods and the special pathological characteristics of vesicle virus, there is no quick and accurate method to measure vesicle virus titer. Spend

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Absolute quantitative PCR method for rapidly determining titer of ascoviruses
  • Absolute quantitative PCR method for rapidly determining titer of ascoviruses
  • Absolute quantitative PCR method for rapidly determining titer of ascoviruses

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0025] Example 1 Primer Design

[0026] According to the publicly published vesicular virus HvAV-3h sequence, a single-copy region on the genome was selected to design specific primers, and the designed primers were screened to obtain a set of primer pairs with better specificity, stability and higher sensitivity. The nucleotide sequence is as follows:

[0027] AV-F: ATGAAAGCCGTGCTTAACGT (SEQ ID NO. 1),

[0028] AV-R: CTAGCCGGTGTGGTGGGTGT (SEQ ID NO. 2);

[0029] Using vesicle virus-infected cell genome and AV standard as template, the amplified sequence is:

[0030] ctagccggtgtggtgggtgtcgtatgtaatgcagttcgtcagaatgtctctaccgaagataatggtgtgtgtttcactattctcactctggaaaagcctccgcgtattagcgatcagaacgttaagcacggctttcat (SEQ ID NO. 3); the length of the amplified fragment is 138 bp.

[0031] According to the experimental detection results, the melting curves of the quantitative PCR amplification using the vesicle virus-infected cell genome and the AV standard as templates are consistent, in...

Embodiment 2

[0032] The rapid determination of embodiment 2 vesicular virus HvAV-3h titer

[0033] 1. Virus collection and sample processing

[0034] Collect the hemolymph of beet armyworm infected with vesicle virus HvAV-3h strain 7 days in a 1.5ml centrifuge tube, sonicate (20w, 6min), and use Sf-900 II SFM medium for 10-fold serial dilution, and the dilution factor is (10 2 ~10 7 ), filtered through a 0.22 μm filter and stored at 4°C for later use.

[0035] 2. Cell Infection and Counting

[0036] Inoculate SeFB cells in a 6-well plate, and when the cells adhere to the wall and grow to 80-90% monolayer confluence, discard the supernatant and add 2 mL / well of the above virus dilution, with 3 replicates for each gradient concentration, and keep the temperature at 27°C Incubate for 1 hour, wash twice with PBS, collect the cells in a 1.5ml centrifuge tube, and count the number of virus cells with a hemocytometer.

[0037] 3. Calculation of viral genome copy number

[0038]The collected ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to an absolute quantitative PCR method for rapidly determining the titer of ascoviruses. The absolute quantitative PCR method comprises the following steps: ultrasonically crushing a to-be-detected sample containing the ascoviruses, carrying out diluting and filtering, allowing the ascoviruses to infect cells in a logarithmic phase for 1 hour, collecting a cell suspension, calculating the number of the cells, and extracting total DNA; carrying out qPCR detection on the DNA, and drawing a standard curve of absolute quantitative PCR detection by taking a pGEM-T vector containing the fragment of the DNA as a standard substance; calculating the copy number of a virus genome contained in each sample according to the Ct value of each sample; and according to an infection complex number formula, calculating the average number of virus particles infecting each cell, namely the ratio of the number of viruses to the number of the cells during infection so as to calculate the titer of the viruses. The absolute quantitative PCR method provided by the invention is used for measuring the titer of the ascoviruses; the detection time is only 4-6 hours when the concentration of a sample is 1 * 10<2> to 1 * 10<11> virus gene copy / mL, so the consumed time is short; compared with a traditional virus titer detection method, the absolute quantitative PCR method provided by theinvention has simple and rapid operation, is accurate, greatly improves the detection efficiency of the titer of the ascoviruses, and is especially applicable to rapid determination of the titer of the ascoviruses.

Description

technical field [0001] The invention belongs to the field of biotechnology, and in particular relates to an absolute quantitative PCR method for rapidly measuring vesicle virus titer. Background technique [0002] Ascoviruses is a collective term for all strains of the family Ascoviridae, whose genome is circular double-stranded DNA with a size between 100-200kb. The oral infection rate of vesicle virus is extremely low, and it mainly relies on parasitoid wasps to carry and spread among individuals of Lepidoptera larvae. After the vesicle virus infects the host larvae, the host larvae show symptoms such as growth retardation, decreased muscle elasticity, and reduced food intake. In the late stage of host larvae infection, vesicles containing virus particles are released into the hemolymph, and the host larval hemolymph is formed by Colorless and transparent to milky white, forming typical symptoms of vesicular virus infection. The infection process of vesicle virus to host...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/70C12Q1/686
CPCC12Q1/701C12Q1/686C12Q2545/114Y02A50/30
Inventor 黄国华宋晓慧李梓琦黎妮
Owner HUNAN AGRICULTURAL UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com