Absolute quantitative PCR method for rapidly determining titer of ascoviruses
What is Al technical title?
Al technical title is built by PatSnap Al team. It summarizes the technical point description of the patent document.
An absolute quantitative, virus titer technology, applied in biochemical equipment and methods, microbial determination/inspection, resistance to vector-borne diseases, etc. and other problems, to achieve the stability of experimental results, improve detection efficiency, and reduce time-consuming effects.
Active Publication Date: 2020-06-05
HUNAN AGRICULTURAL UNIV
View PDF2 Cites 3 Cited by
Summary
Abstract
Description
Claims
Application Information
AI Technical Summary
This helps you quickly interpret patents by identifying the three key elements:
Problems solved by technology
Method used
Benefits of technology
Problems solved by technology
However, the calculation of cell staining results is easily affected by the staining time, the concentration of the staining solution, etc., and the method has a large workload, requiring staining in a short period of time and calculating the staining rates of hundreds of groups of cells at different dilutions. The counting process is complicated and time-consuming and labor-intensive. With
Method used
the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more
Image
Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
Click on the blue label to locate the original text in one second.
Reading with bidirectional positioning of images and text.
Smart Image
Examples
Experimental program
Comparison scheme
Effect test
Embodiment 1
[0025] Example 1 Primer Design
[0026] According to the publicly published vesicular virus HvAV-3h sequence, a single-copy region on the genome was selected to design specific primers, and the designed primers were screened to obtain a set of primer pairs with better specificity, stability and higher sensitivity. The nucleotide sequence is as follows:
[0027] AV-F: ATGAAAGCCGTGCTTAACGT (SEQ ID NO. 1),
[0028] AV-R: CTAGCCGGTGTGGTGGGTGT (SEQ ID NO. 2);
[0029] Using vesicle virus-infected cell genome and AV standard as template, the amplified sequence is:
[0030] ctagccggtgtggtgggtgtcgtatgtaatgcagttcgtcagaatgtctctaccgaagataatggtgtgtgtttcactattctcactctggaaaagcctccgcgtattagcgatcagaacgttaagcacggctttcat (SEQ ID NO. 3); the length of the amplified fragment is 138 bp.
[0031] According to the experimental detection results, the melting curves of the quantitative PCR amplification using the vesicle virus-infected cell genome and the AV standard as templates are consistent, in...
Embodiment 2
[0032] The rapid determination of embodiment 2 vesicular virus HvAV-3h titer
[0033] 1. Virus collection and sample processing
[0034] Collect the hemolymph of beet armyworm infected with vesicle virus HvAV-3h strain 7 days in a 1.5ml centrifuge tube, sonicate (20w, 6min), and use Sf-900 II SFM medium for 10-fold serial dilution, and the dilution factor is (10 2 ~10 7 ), filtered through a 0.22 μm filter and stored at 4°C for later use.
[0035] 2. Cell Infection and Counting
[0036] Inoculate SeFB cells in a 6-well plate, and when the cells adhere to the wall and grow to 80-90% monolayer confluence, discard the supernatant and add 2 mL / well of the above virus dilution, with 3 replicates for each gradient concentration, and keep the temperature at 27°C Incubate for 1 hour, wash twice with PBS, collect the cells in a 1.5ml centrifuge tube, and count the number of virus cells with a hemocytometer.
[0037] 3. Calculation of viral genome copy number
[0038]The collected ...
the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more
PUM
Login to view more
Abstract
The invention relates to an absolute quantitative PCR method for rapidly determining the titer of ascoviruses. The absolute quantitative PCR method comprises the following steps: ultrasonically crushing a to-be-detected sample containing the ascoviruses, carrying out diluting and filtering, allowing the ascoviruses to infect cells in a logarithmic phase for 1 hour, collecting a cell suspension, calculating the number of the cells, and extracting total DNA; carrying out qPCR detection on the DNA, and drawing a standard curve of absolute quantitative PCR detection by taking a pGEM-T vector containing the fragment of the DNA as a standard substance; calculating the copy number of a virus genome contained in each sample according to the Ct value of each sample; and according to an infection complex number formula, calculating the average number of virus particles infecting each cell, namely the ratio of the number of viruses to the number of the cells during infection so as to calculate the titer of the viruses. The absolute quantitative PCR method provided by the invention is used for measuring the titer of the ascoviruses; the detection time is only 4-6 hours when the concentration of a sample is 1 * 10<2> to 1 * 10<11> virus gene copy/mL, so the consumed time is short; compared with a traditional virus titer detection method, the absolute quantitative PCR method provided by theinvention has simple and rapid operation, is accurate, greatly improves the detection efficiency of the titer of the ascoviruses, and is especially applicable to rapid determination of the titer of the ascoviruses.
Description
technical field [0001] The invention belongs to the field of biotechnology, and in particular relates to an absolute quantitative PCR method for rapidly measuring vesicle virus titer. Background technique [0002] Ascoviruses is a collective term for all strains of the family Ascoviridae, whose genome is circular double-stranded DNA with a size between 100-200kb. The oral infection rate of vesicle virus is extremely low, and it mainly relies on parasitoid wasps to carry and spread among individuals of Lepidoptera larvae. After the vesicle virus infects the host larvae, the host larvae show symptoms such as growth retardation, decreased muscle elasticity, and reduced food intake. In the late stage of host larvae infection, vesicles containing virus particles are released into the hemolymph, and the host larval hemolymph is formed by Colorless and transparent to milky white, forming typical symptoms of vesicular virus infection. The infection process of vesicle virus to host...
Claims
the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more
Application Information
Patent Timeline
Application Date:The date an application was filed.
Publication Date:The date a patent or application was officially published.
First Publication Date:The earliest publication date of a patent with the same application number.
Issue Date:Publication date of the patent grant document.
PCT Entry Date:The Entry date of PCT National Phase.
Estimated Expiry Date:The statutory expiry date of a patent right according to the Patent Law, and it is the longest term of protection that the patent right can achieve without the termination of the patent right due to other reasons(Term extension factor has been taken into account ).
Invalid Date:Actual expiry date is based on effective date or publication date of legal transaction data of invalid patent.
Login to view more 
Login to view more