Virus lysis reaction solution suitable for rapid direct expansion PCR detection
A cracking reaction and virus technology, applied in specific-purpose bioreactor/fermenter, bioreactor/fermenter combination, biological material sampling method, etc. Time and other issues
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0032] 2. Example 1: Two-enzyme one-step RNA amplification detection
[0033] a. Preparation of Primer-Probe Enzyme Master Mix A
[0034] The final concentration of each component in the 100ul reaction system is: 0.5U / ul anti-inhibitory high-temperature reverse transcriptase TOROIVD® III (TOROIVD) (or reverse transcriptase such as SuperScriptTM IV / III (Thermo) or ReverTra Ace® (TOYOBO)) ; 5U anti-inhibitor hot-start PCR enzyme TOROIVD® 5G polymerase (TOROIVD) (or use TTX polymerase (TOYOBO), Hawk fast Z05 and other polymerases (Roche)); 50U RNase inhibitor (TOYOBO or TOROIVD); 1mM DTT ; 2uM dNTP (or replace dTTP with 1-2 times UTP); 10U of UNG enzyme (TOYOBO or TOROIVD); 5uM upstream and downstream primers and 5uM probe mix. The Ms2 primer and probe sequences used in this case are as follows:
[0035] Upstream primer: 5'-TCCTGCTCAACTTCCTGTCGAG-3'
[0036] Downstream primer: 5'-CACAGGTCAAAACCTCCTAGGAATG-3')
[0037] Taqman probe: FAM-CCCGTGGGATGCTCCTACATGTCA-TAMRA
[0038]...
Embodiment 2
[0041] 3. Example 2: DNA amplification detection by single enzyme method
[0042] a. Prepare Primer-Probe Enzyme Master Mix B
[0043] The final concentration of its components is: 5U anti-inhibitory hot-start PCR enzyme TOROIVD® 5G polymerase (TOROIVD) (or use TTX polymerase (TOYOBO), Hawk fast Z05 and other polymerases (Roche)); 2uM dNTP (or replace dTTP 1-2 times UTP); 10U UNG enzyme (TOYOBO or TOROIVD); 5uM upstream and downstream primers and 5uM probe mixture.
[0044] The ORF1ab primer probe sequence published by CDC for 2019-nCov is as follows:
[0045] Forward primer (F): CCCTGTGGGTTTTACACTTAA
[0046] Reverse primer (R): ACGATTGTGCATCAGCTGA
[0047] Fluorescent probe (P): 5'-FAM-CCGTCTGCGGTATGTGGAAAGGTTATGG-BHQ1-3'
[0048] b. 2019-nCoV-CDC positive plasmid amplification detection
[0049]Dip the throat swab with 2019-nCoV-CDC positive plasmid sample solution diluted in different concentrations, place it in a virus sampling tube containing 1ml lysis reaction solu...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap