Virus lysis reaction solution suitable for rapid direct expansion PCR detection

A cracking reaction and virus technology, applied in specific-purpose bioreactor/fermenter, bioreactor/fermenter combination, biological material sampling method, etc. Time and other issues

Inactive Publication Date: 2020-06-05
天罗诊断科技江苏有限公司 +1
View PDF4 Cites 7 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] The disadvantage of the existing virus DNA / RNA extraction method is that the operation steps are cumbersome and time-consuming, which is not conducive to the rapid detection of on-site samples; Different, it will affect the nucleic acid detection of viral nucleic acid, especially the critical positive sample to a certain extent

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Virus lysis reaction solution suitable for rapid direct expansion PCR detection
  • Virus lysis reaction solution suitable for rapid direct expansion PCR detection
  • Virus lysis reaction solution suitable for rapid direct expansion PCR detection

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0032] 2. Example 1: Two-enzyme one-step RNA amplification detection

[0033] a. Preparation of Primer-Probe Enzyme Master Mix A

[0034] The final concentration of each component in the 100ul reaction system is: 0.5U / ul anti-inhibitory high-temperature reverse transcriptase TOROIVD® III (TOROIVD) (or reverse transcriptase such as SuperScriptTM IV / III (Thermo) or ReverTra Ace® (TOYOBO)) ; 5U anti-inhibitor hot-start PCR enzyme TOROIVD® 5G polymerase (TOROIVD) (or use TTX polymerase (TOYOBO), Hawk fast Z05 and other polymerases (Roche)); 50U RNase inhibitor (TOYOBO or TOROIVD); 1mM DTT ; 2uM dNTP (or replace dTTP with 1-2 times UTP); 10U of UNG enzyme (TOYOBO or TOROIVD); 5uM upstream and downstream primers and 5uM probe mix. The Ms2 primer and probe sequences used in this case are as follows:

[0035] Upstream primer: 5'-TCCTGCTCAACTTCCTGTCGAG-3'

[0036] Downstream primer: 5'-CACAGGTCAAAACCTCCTAGGAATG-3')

[0037] Taqman probe: FAM-CCCGTGGGATGCTCCTACATGTCA-TAMRA

[0038]...

Embodiment 2

[0041] 3. Example 2: DNA amplification detection by single enzyme method

[0042] a. Prepare Primer-Probe Enzyme Master Mix B

[0043] The final concentration of its components is: 5U anti-inhibitory hot-start PCR enzyme TOROIVD® 5G polymerase (TOROIVD) (or use TTX polymerase (TOYOBO), Hawk fast Z05 and other polymerases (Roche)); 2uM dNTP (or replace dTTP 1-2 times UTP); 10U UNG enzyme (TOYOBO or TOROIVD); 5uM upstream and downstream primers and 5uM probe mixture.

[0044] The ORF1ab primer probe sequence published by CDC for 2019-nCov is as follows:

[0045] Forward primer (F): CCCTGTGGGTTTTACACTTAA

[0046] Reverse primer (R): ACGATTGTGCATCAGCTGA

[0047] Fluorescent probe (P): 5'-FAM-CCGTCTGCGGTATGTGGAAAGGTTATGG-BHQ1-3'

[0048] b. 2019-nCoV-CDC positive plasmid amplification detection

[0049]Dip the throat swab with 2019-nCoV-CDC positive plasmid sample solution diluted in different concentrations, place it in a virus sampling tube containing 1ml lysis reaction solu...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The present invention belongs to the field of virus detection and particularly relates to a virus lysis reaction solution suitable for a rapid direct expansion PCR detection. The virus lysis reactionsolution has three functions of a swab sample sampling solution, a sample lysis solution and an amplification reaction buffer solution, avoids problems that a traditional nucleic acid detection systemneeds nucleic acid extraction steps, takes long time, is low in detection sensitivity due to a small sample processing amount, etc., and also avoids a defect of low sensitivity caused by too low actual sampling volume in a ''one-step lysis method'' and an ''extraction-free direct expansion method'' established in recent years. The virus lysis reaction solution is particularly suitable for screening of human and animal infectious diseases, especially the safety screening of high-risk respiratory viruses.

Description

technical field [0001] The invention belongs to the field of virus detection, and in particular relates to a virus lysis reaction solution suitable for rapid direct amplification PCR detection. Background technique [0002] Polymerase chain reaction (PCR) is a useful tool for rapid detection of food, environmental, and clinical samples, especially in rapid detection of infectious diseases. The standard operating procedures for nucleic acid detection are generally sample collection, transportation, and nucleic acid extraction. , PCR detection, and for some infectious disease viruses, relevant regulations require reliable inactivation of the original sample before nucleic acid extraction. [0003] A typical PCR reaction requires a pretreatment step of DNA / RNA extraction and purification to remove many factors that inhibit the PCR reaction. This pretreatment step usually takes 0.5 hours to complete. [0004] The disadvantage of the existing virus DNA / RNA extraction method is t...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/70C12Q1/686C12Q1/24C12M1/26C12M1/24
CPCC12Q1/701C12Q1/686C12Q1/24C12Q2527/125C12Q2527/127
Inventor 王继国陈普李振海
Owner 天罗诊断科技江苏有限公司
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap