Unlock instant, AI-driven research and patent intelligence for your innovation.

7alpha-hydroxysteroid dehydrogenase (St-2-2) mutants

A technology of hydroxysteroids and dehydrogenases, applied in the field of mutants, can solve problems such as transformations that have not been seen yet, and achieve the effects of improving catalytic efficiency, high catalytic efficiency, and huge application value

Active Publication Date: 2020-06-09
CHONGQING UNIV
View PDF2 Cites 10 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

At present, there is no relevant report on the modification of this enzyme

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • 7alpha-hydroxysteroid dehydrogenase (St-2-2) mutants
  • 7alpha-hydroxysteroid dehydrogenase (St-2-2) mutants
  • 7alpha-hydroxysteroid dehydrogenase (St-2-2) mutants

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0028] Example 1. Preparation of 7α-hydroxysteroid dehydrogenase (St-2-2) mutant

[0029] 1. Mutant Gene Synthesis

[0030] The amino acid sequence (262aa) of wild-type 7α-hydroxysteroid dehydrogenase St-2-2 is as follows:

[0031] MKRVENKVALVTSSTRGIGLAIAKTLAKEGARVYLAVRRLDAGQEVANEIIAEGGFAKPVYFDASKVETHMSMIEEVVEAEGRIDILVNNYGSTDVQKDLDLVHGDTEAFFNIVNQNLESVYLPCKVAVPYMIKNGGGSIINISTIGSVNPDLGRIAYVVSKAAINALTQNIAVQYAKKGIRCNAVLPGLIATDAALNNMSEEFLEHFLRHVPLDRTGHPQDIANAVLFFASDESSYITGTLQEVAGGFGMPSP I YGDAVKK (SEQ ID NO: 1)

[0032] The nucleotide sequence (789bp) of wild-type 7α-hydroxysteroid dehydrogenase St-2-2 is as follows:

[0033] ATGAAAAGAGTAGAAAATAAAGTAGCATTAGTCACATCTTCTACAAGAGGGATTGGACTTGCTATTGCTAAAACACTTGCTAAAGAAGGTGCACGTGTATACCTTGCAGTAAGAAGATTAGATGCAGGTCAGGAGGTAGCGAATGAAATTATTGCAGAAGGTGGATTTGCTAAGCCTGTTTACTTTGATGCTTCTAAAGTAGAGACACACATGAGTATGATTGAAGAAGTAGTTGAAGCTGAAGGACGTATAGATATTTTAGTCAATAATTATGGTTCAACAGACGTTCAAAAGGACTTAGATCTCGTACATGGAGATACAGAAGCTTTCTTTAATATTGTTAATCAAAATCTTGAAAGT...

Embodiment 2

[0109] Example 2. Enzyme activity assay of 7α-hydroxysteroid dehydrogenase (St-2-2) mutant

[0110] 1. Preparation of NADPH standard curve

[0111] 0mM, 0.1mM, 0.2mM, 0.3mM, 0.4mM NADPH solutions were respectively prepared using reaction buffer (50mM Tris-HCl, pH 8.0). After zeroing with the above blank solvent (50mM Tris-HCl, pH 8.0), add NADPH solutions of various concentrations into 2mL cuvettes respectively, and measure the light absorption value OD at 340nm at room temperature 340 . With the concentration of NADPH solution as the abscissa and the corresponding 340nm light absorption value as the ordinate, a standard curve is drawn. The result is as Figure 4 As shown, the obtained standard curve equation is y=2.79559x-0.0003, R 2 = 0.9999.

[0112] The preparation method of the reaction buffer solution (50mM Tris-HCl, pH 8.0) is: take 6.057g Tris solid powder and dissolve it in 1L deionized water, adjust the pH to 8.0 with hydrochloric acid, and place it at room temp...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to hydroxysteroid dehydrogenase, and in particular to 7alpha-hydroxysteroid dehydrogenase (St-2-2) mutants. The amino acid sequences of the mutants are shown as SEQ ID NO:2, 3, 4, 5, 6, 7, 8, 9 or 10, and are obtained by changing the 255th amino acid of the 7alpha-hydroxysteroid dehydrogenase with an amino acid sequence of SEQ ID NO:1 from Ile to Tyr, Gln, Leu, Thr, Gly, Asn,Ser, Ala or Phe. In the presence of same substrates TCDCA and NADP<+>, enzyme activity of the mutants is respectively 1.49, 1.78, 1.79, 1.79, 1.93, 2.44, 2.58, 2.97 and 3.34 times of enzyme activityof a wild type hydroxysteroid dehydrogenase, and the mutant has a great application potential in a process of obtaining tauroursodeoxycholic acid (TUDCA) through biotransformation of taurochenodeoxycholic acid (TCDCA).

Description

technical field [0001] The present invention relates to hydroxysteroid dehydrogenase, in particular to mutants I255Y, I255Q, I255L, I255T, I255G, I255N, I255S, I255A and I255F of 7α-hydroxysteroid dehydrogenase (St-2-2). Background technique [0002] The asymmetric reduction of carbonyl groups has always been one of the hotspots in chemical reaction research. Although the current chemical methods have achieved certain results, they often have disadvantages such as limited types and numbers of catalysts, low stereoselectivity, expensive auxiliary reagents, and difficult recovery. The enzymatic reaction not only has high efficiency, chemoselectivity, regioselectivity, but also a high degree of stereoselectivity. The enzymatic reaction mediated by hydroxysteroid dehydrogenase (Hydroxysteroid dehydrogenase, HSDH) has relatively strict stereoselectivity and "not" strict substrate specificity. For example, as early as the early 1980s, scientists have begun to use 7α-, 7β-HSDH pr...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N9/04C12N15/53C12N15/70C12N1/21C12P33/02C12R1/19
CPCC12N9/0006C12N15/70C12P33/02C12Y101/01159
Inventor 祝连彩王伯初潘银平唐士金赵文艳杨碧玲
Owner CHONGQING UNIV
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More