A closed sars-cov-2 isothermal amplification nucleic acid detection kit
A sars-cov-2, kit technology, applied in DNA/RNA fragments, recombinant DNA technology, microbial determination/inspection, etc., can solve the problem that it is difficult to achieve real-time detection of new coronavirus pneumonia on-site and without nucleic acid extraction. steps, unfavorable rapid detection and other problems, to avoid secondary pollution, low detection cost, and good specificity
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0050] This embodiment provides a closed SARS-COV-2 isothermal amplification nucleic acid detection kit comprising a reaction premix A, a reaction premix B, an HNB developer, a detection tube, a standard positive template, a negative control. The reaction premix is composed of reaction premix A and a reaction premix B. Among them, the reaction premixed solution A includes a BST DNA large fragment polymerase, an AMV reverse transcriptase; the reaction premix B includes a 10X reaction buffer, a primer group, DNTPS, magnesium sulfate, betaine, 6 wt% formamide and DEPC water.
[0051] The primer group includes a pair of outer primers F3-1 and B3-1, a pair of inner primers FIP-1 and BIP-1, and a pair of circular lead LF-1, LB-1.
[0052] The nucleotide sequences of F3-1, B3-1, FIP-1, BIP-1, LF-1, and LB-1 are as follows:
[0053] F3-1 (SEQ ID NO.1): 5'ctagegttcaaactttactTGC3 ';
[0054] B3-1 (SEQ ID No.2): 5'cctttttctacagtgaaggatt3 ';
[0055] FIP-1 (SEQ ID NO.3):
[0056] 5'cacataat...
Embodiment 2
[0071] Clinical verification is carried out in conjunction with the requirements of the detection standards detected by the kits of the present invention.
[0072] LAMP detection results and QPCR detection comparison
[0073]
[0074] LAMP positive detection rate of positive samples: 100%
[0075] LAMP positive detection rate of negative samples: 100%
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


