Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

A closed sars-cov-2 isothermal amplification nucleic acid detection kit

A sars-cov-2, kit technology, applied in DNA/RNA fragments, recombinant DNA technology, microbial determination/inspection, etc., can solve the problem that it is difficult to achieve real-time detection of new coronavirus pneumonia on-site and without nucleic acid extraction. steps, unfavorable rapid detection and other problems, to avoid secondary pollution, low detection cost, and good specificity

Active Publication Date: 2022-02-11
GUANGDONG GENERAL HOSPITAL +1
View PDF1 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0003] (1) More than 90% of them are in the form of nucleic acid diagnostic kits, which need to be extracted, amplified and tested. The operation is cumbersome and requires professionals and complex P2 laboratories. It is difficult to realize the on-site detection of new coronavirus pneumonia (COVID-19) Real-time detection;
[0004] (2) Most of the qPCR methods are used, and the detection time is relatively long (about 4 hours) due to the heating and cooling cycles involved, which is not conducive to rapid on-site detection;
However, the isothermal amplification kits developed by the above companies have not yet achieved the step of exempting nucleic acid extraction.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A closed sars-cov-2 isothermal amplification nucleic acid detection kit
  • A closed sars-cov-2 isothermal amplification nucleic acid detection kit

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0050] This embodiment provides a closed SARS-COV-2 isothermal amplification nucleic acid detection kit comprising a reaction premix A, a reaction premix B, an HNB developer, a detection tube, a standard positive template, a negative control. The reaction premix is ​​composed of reaction premix A and a reaction premix B. Among them, the reaction premixed solution A includes a BST DNA large fragment polymerase, an AMV reverse transcriptase; the reaction premix B includes a 10X reaction buffer, a primer group, DNTPS, magnesium sulfate, betaine, 6 wt% formamide and DEPC water.

[0051] The primer group includes a pair of outer primers F3-1 and B3-1, a pair of inner primers FIP-1 and BIP-1, and a pair of circular lead LF-1, LB-1.

[0052] The nucleotide sequences of F3-1, B3-1, FIP-1, BIP-1, LF-1, and LB-1 are as follows:

[0053] F3-1 (SEQ ID NO.1): 5'ctagegttcaaactttactTGC3 ';

[0054] B3-1 (SEQ ID No.2): 5'cctttttctacagtgaaggatt3 ';

[0055] FIP-1 (SEQ ID NO.3):

[0056] 5'cacataat...

Embodiment 2

[0071] Clinical verification is carried out in conjunction with the requirements of the detection standards detected by the kits of the present invention.

[0072] LAMP detection results and QPCR detection comparison

[0073]

[0074] LAMP positive detection rate of positive samples: 100%

[0075] LAMP positive detection rate of negative samples: 100%

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to the technical field of viral nucleic acid detection methods, specifically a SARS-CoV-2 RT-LAMP nucleic acid detection primer set and a closed SARS-CoV-2 isothermal amplification nucleic acid detection kit. The kit of the present invention does not need nucleic acid extraction for virus RNA of throat swab samples, and can directly amplify the samples. It is a one-step visualized real-time screening kit for SARS-CoV-2, which has good specificity and can exclude other The non-specific interference of coronavirus strains is fast and efficient, and the detection can be completed within 1 hour, and does not require large, expensive and sophisticated instruments and equipment, only ordinary metal baths or water baths are needed, the detection cost is low, and the whole process does not involve toxic reagents. Closed operation avoids secondary pollution and ensures the safety of operators and the environment.

Description

Technical field [0001] The present invention relates to the technical findings of viral nucleic acid detection methods, and more particularly to an RT-LAMP nucleic acid detection primer group of SARS-COV-2, and a closed SARS-COV-2 isothermal expansion nucleic acid detection kit. Background technique [0002] With the release of "new coronavirus infected pneumonia diagnosis, nucleic acid detection as an important criterion for diagnosis, its importance is generally recognized. However, nucleic acid detection involves extraction, amplification, detection, etc., which requires high requirements for laboratory environment and operators, and a complete new crown virus nucleic acid detection process often requires professional testers to pass two consecutive hands, involving large-scale Fluorescence quantitative PCR instrument, so the popularity and field application of nucleic acid detection are limited, thereby causing a large number of patients with clinical symptoms that cannot be ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12Q1/70C12Q1/6844C12N15/11C12R1/93
CPCC12Q1/701C12Q1/6844C12Q2531/119C12Q2521/107
Inventor 侯铁英胡雪姣李杉吴际廖亚龙郑有为张雷
Owner GUANGDONG GENERAL HOSPITAL
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products