Soybean branch number molecular marker and application thereof

A technology of molecular markers and molecular marker sequences, which is applied in the field of biotechnology and genetic engineering, and can solve the problems of complex soybean genome and genetic structure

Inactive Publication Date: 2020-06-26
INST OF CROP SCI CHINESE ACAD OF AGRI SCI
View PDF8 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] However, due to the complexity of the soybean genome, there are a large number of repetitive sequences; the number of branches is a quantitative trait controlled by multiple genes, and the genetic structure is complex, so the research on soybean branching traits is still in its infancy, and there is no map-based cloning of new genes. to report

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Soybean branch number molecular marker and application thereof
  • Soybean branch number molecular marker and application thereof
  • Soybean branch number molecular marker and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0052] A soybean molecular marker, the soybean molecular marker includes: a DNA molecule obtained by using soybean genomic DNA as a template and using primers to amplify BR69; and, using soybean genomic DNA as a template and using primers to amplify BR77 DNA molecule.

[0053] The BR69 primer pair includes:

[0054] BR69-F: 5'-AGTTGACAGGAACTAAAGT-3', as shown in SEQ ID NO.1;

[0055] BR69-R: 5'-GATAATTCAAGTAAATAGCGA-3', as shown in SEQ ID NO.2;

[0056] The BR77 primer pair includes:

[0057] BR77-F: 5'-TCTCTTTGTGTATGTCTTTCTCC-3', as shown in SEQ ID NO.3;

[0058] BR77-R: 5'-TTGTTGCATCCAAATGAGAG-3', as shown in SEQ ID NO.4.

[0059] Wherein, in DNA molecule a, the soybean molecular marker sequence of KF19 is:

[0060] ATTTTTTTATTGAATAAAATCAAAATAATCCTATTTTTAAAAACTAAAATTAAGTCTTTTTTTTTACATGCTAGTTAAAGTAATACTTAAGTTTATAACTTTATTAACCTTTTCATTTTTACTTATTGATGTAATCTCTTTTTATATA, as shown in SEQ ID NO.5;

[0061] In the DNA molecule a, the soybean molecular marker sequence of KN24 is: ...

Embodiment 2

[0091] The method for assisting the identification of soybean branch number establishment is as follows:

[0092] Extract the genomic DNA of the soybean to be tested, and use the genomic DNA as a template to perform PCR amplification on BR69 and BR77 using primers (PCR reaction program: 95°C 5min; 95°C 30S, 55°C 30S, 72°C 30S, 35 cycles ; 72°C for 10 min.), followed by 6% non-denaturing polyacrylamide gel electrophoresis and silver nitrate staining. Then make the following judgments:

[0093] Using the genomic DNA of the soybean to be tested as a template, use the specific primers BR69 and BR77 to carry out PCR amplification to obtain the length of the PCR product. If the PCR product of BR69 is 156bp and the PCR product of BR77 is 268bp, then the PCR product to be tested The number of branches of soybean is multi-branched or the candidate is multi-branched; if the PCR product of BR69 is not 156bp or the PCR product of BR77 is not 268bp, the number of branches of the soybean t...

Embodiment 3

[0094] Embodiment 3 identifies F7 population and soybean branch number according to the method established in embodiment 2

[0095] The actual number of branches of each individual plant in the constructed Kennong 24 / Kenfeng 19F7 population was recorded, and the experimental results are shown in Table 2. Randomly get 30 multi-branched individual plants and 30 less-branched individual plants, and identify them according to the method established in Example 2. Electrophoresis after PCR amplification of BR69 using primers figure 2 with image 3 ( figure 2 Middle A is the electrophoresis image of 30 multi-branched single plants, in which lanes 1 to 30 are multi-branched single plants numbered 1 to 30, lane 31 is Kennong 24, and lane 32 is Kenfeng 19; image 3 Middle B is the electrophoresis of 30 less-branched individuals, in which lanes 1 to 30 are the less-branched individuals numbered 31 to 60, lane 31 is Kennong 24, and lane 32 is Kenfeng 19). Electrophoresis after PCR a...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a soybean molecular marker, a method for obtaining the soybean molecular marker and an application of the soybean molecular marker. The molecular marker is obtained by adoptinga map-based cloning mode; genome DNA is amplified by using a specific primer pair; and the obtained molecular marker is applied to identification of soybean branch number. The map-based cloning method is utilized to locate and clone a multi-branch decisive base sequence in a multi-branch soybean genome, and whether soybeans are multi-branch soybeans or not is determined according to a cloning result, so the soybeans are planted, and the yield of the soybeans is increased.

Description

technical field [0001] The present invention relates to the field of biotechnology and genetic engineering technology, more specifically to soybean polymorphic molecular markers and their application in identifying the number of soybean branches Background technique [0002] Soybean (Glycinemax (L.)) is the main food crop in my country, not only the main source of high-quality protein, but also an important grain and oil crop. my country's perennial soybean planting area is about 90 million mu, with a total output of 12 million tons (average per unit yield of 12 plus kg / mu); with the improvement of people's living standards and the rapid development of the breeding industry, my country's soybeans are far from meeting the demand, and the self-sufficiency rate is declining every year 3.6%. Therefore, the import volume continues to increase. In 2017, the import volume was 95.53 million tons, and the dependence on imported soybeans was more than 85%. Based on the current nation...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12Q1/6895C12N15/11
CPCC12Q1/6895C12Q2600/156C12Q2600/13
Inventor邱丽娟吴海涛
OwnerINST OF CROP SCI CHINESE ACAD OF AGRI SCI