DNA fragment, primer and detection method for identifying brucella A19/S19 strain and other strains
A Brucella and detection method technology, applied in the field of pathogen detection, can solve the problems of indistinguishability, time-consuming, economic loss, etc., and achieve the effects of good prevention and control, avoiding economic loss, and high accuracy
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0027] A specific DNA fragment for identifying Brucella A19 / S19 strains and other Brucella strains, the nucleotide sequence of the specific DNA fragment is SEQ ID No.1: CCGGTGTGGTCGCGGGCTTCCTGATGCAGGGCGTGACCTTGCAGGAATTCGGCATCATCCTTTATTTC, see the sequence table, The specific DNA fragment is obtained by online BLAST. When the fragment is selected by online BLAST, the sequence is missing in Brucella A19 and S19 strains, and the sequence is ubiquitous in other Brucella strains.
[0028] Present embodiment provides a kind of application that is used to distinguish the specific DNA fragment of Brucella A19 / S19 strain and other Brucella bacterial strains, and described specific DNA fragment is used for detecting and distinguishing Brucella A19 / S19 strains and other strains of Brucella.
[0029] A PCR primer for distinguishing Brucella A19 / S19 strains and other Brucella bacterial strains, comprising upstream primer SEQID No.2 and downstream primer SEQ ID No.3, named after A19 / S19F an...
Embodiment 2
[0034] A detection method for distinguishing brucella A19 / S19 strains and other brucella bacterial strains, comprising the following steps:
[0035] (1) dip a cotton swab to pick up the abortion secretion of animals immunized with Brucella A19 or S19 vaccine, put it into TRIzol to extract the genome of the abortion secretion;
[0036] (2) Take 1 ul of the genome extracted from the abortion secretion as a template, and prepare a 20 ul reaction system, including 10 μl of 2×AceTaq Master Mix (Dye Plus), 1 μl of 20 μM forward primer A19 / S19F, and 20 μM of reverse primer A19 / S19R 1 μl, ddH2O 7 μl, put the thin-walled PCR tube containing the above reaction system into the PCR instrument, perform pre-denaturation at 94°C for 3 minutes, denaturation at 94°C for 30s, annealing at 58°C for 30s, extension at 72°C for 30s, and the reaction ends after 30 cycles;
[0037] (3) Take 5ul of the product of the PCR amplification reaction and add it to a 2% agarose gel sample hole for electrophor...
Embodiment 3
[0039] A detection method for distinguishing brucella A19 / S19 strains and other brucella bacterial strains, comprising the following steps:
[0040] (1) Cotton swabs are dipped in the blood of cattle immunized with Brucella A19 or S19 vaccine, and the genome in the blood is extracted;
[0041] (2) Take 1 ul of the extracted blood genome as a template and prepare a 20 ul reaction system, including 10 μl of 2×Ace TaqMaster Mix (Dye Plus), 1 μl of 20 μM forward primer A19 / S19F, 1 μl of 20 μM reverse primer A19 / S19R, ddH2O 7 μl, put the thin-walled PCR tube containing the above reaction system into the PCR machine, perform pre-denaturation at 94°C for 3 minutes, denaturation at 94°C for 30s, annealing at 58°C for 30s, extension at 72°C for 30s, and the reaction ends after 30 cycles;
[0042] (3) Take 5ul of the product of the PCR amplification reaction, add it to the sample hole of 2% agarose gel for electrophoresis detection, and use DL2000 DNA Marker as the molecular weight stan...
PUM

Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com