Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

DNA fragment, primer and detection method for identifying brucella A19/S19 strain and other strains

A Brucella and detection method technology, applied in the field of pathogen detection, can solve the problems of indistinguishability, time-consuming, economic loss, etc., and achieve the effects of good prevention and control, avoiding economic loss, and high accuracy

Pending Publication Date: 2020-07-10
SHENYANG AGRI UNIV
View PDF6 Cites 5 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

There are a variety of detection methods for detecting Brucella, but these methods generally have the problems of complicated operation, time-consuming and high cost, and it is not convenient for rapid detection to guide clinical practice.
At the same time, these detection methods often cannot distinguish Brucella A19 / S19 vaccine strains from other bacterial strains. Therefore, there will be erroneous results that animals carrying A19 or S19 vaccines will be eliminated as wild virus-infected animals, causing serious economic consequences. loss

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • DNA fragment, primer and detection method for identifying brucella A19/S19 strain and other strains
  • DNA fragment, primer and detection method for identifying brucella A19/S19 strain and other strains
  • DNA fragment, primer and detection method for identifying brucella A19/S19 strain and other strains

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0027] A specific DNA fragment for identifying Brucella A19 / S19 strains and other Brucella strains, the nucleotide sequence of the specific DNA fragment is SEQ ID No.1: CCGGTGTGGTCGCGGGCTTCCTGATGCAGGGCGTGACCTTGCAGGAATTCGGCATCATCCTTTATTTC, see the sequence table, The specific DNA fragment is obtained by online BLAST. When the fragment is selected by online BLAST, the sequence is missing in Brucella A19 and S19 strains, and the sequence is ubiquitous in other Brucella strains.

[0028] Present embodiment provides a kind of application that is used to distinguish the specific DNA fragment of Brucella A19 / S19 strain and other Brucella bacterial strains, and described specific DNA fragment is used for detecting and distinguishing Brucella A19 / S19 strains and other strains of Brucella.

[0029] A PCR primer for distinguishing Brucella A19 / S19 strains and other Brucella bacterial strains, comprising upstream primer SEQID No.2 and downstream primer SEQ ID No.3, named after A19 / S19F an...

Embodiment 2

[0034] A detection method for distinguishing brucella A19 / S19 strains and other brucella bacterial strains, comprising the following steps:

[0035] (1) dip a cotton swab to pick up the abortion secretion of animals immunized with Brucella A19 or S19 vaccine, put it into TRIzol to extract the genome of the abortion secretion;

[0036] (2) Take 1 ul of the genome extracted from the abortion secretion as a template, and prepare a 20 ul reaction system, including 10 μl of 2×AceTaq Master Mix (Dye Plus), 1 μl of 20 μM forward primer A19 / S19F, and 20 μM of reverse primer A19 / S19R 1 μl, ddH2O 7 μl, put the thin-walled PCR tube containing the above reaction system into the PCR instrument, perform pre-denaturation at 94°C for 3 minutes, denaturation at 94°C for 30s, annealing at 58°C for 30s, extension at 72°C for 30s, and the reaction ends after 30 cycles;

[0037] (3) Take 5ul of the product of the PCR amplification reaction and add it to a 2% agarose gel sample hole for electrophor...

Embodiment 3

[0039] A detection method for distinguishing brucella A19 / S19 strains and other brucella bacterial strains, comprising the following steps:

[0040] (1) Cotton swabs are dipped in the blood of cattle immunized with Brucella A19 or S19 vaccine, and the genome in the blood is extracted;

[0041] (2) Take 1 ul of the extracted blood genome as a template and prepare a 20 ul reaction system, including 10 μl of 2×Ace TaqMaster Mix (Dye Plus), 1 μl of 20 μM forward primer A19 / S19F, 1 μl of 20 μM reverse primer A19 / S19R, ddH2O 7 μl, put the thin-walled PCR tube containing the above reaction system into the PCR machine, perform pre-denaturation at 94°C for 3 minutes, denaturation at 94°C for 30s, annealing at 58°C for 30s, extension at 72°C for 30s, and the reaction ends after 30 cycles;

[0042] (3) Take 5ul of the product of the PCR amplification reaction, add it to the sample hole of 2% agarose gel for electrophoresis detection, and use DL2000 DNA Marker as the molecular weight stan...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a DNA fragment, a primer and a detection method for identifying a brucella A19 / S19 strain and other strains. The detection method comprises the following operation steps: (1) extracting genomes of samples to be detected; (2) by taking extracted sample genomes as templates, performing PCR amplification; (3) performing electrophoresis detection on products obtained after amplification, so as to obtain results that if strips of 217bp are shown, it means that the detection samples contain the brucella A19 or S19 strain, if strips of 285bp are shown, it means that the detection samples contain other brucella strains except A9 and S19, and if no strip is shown or strips are not 217bp or 285bp, it means that the detection samples do not contain brucella strains and have nobrucella infection. By adopting the method disclosed by the invention, the brucella A19 / S19 strain and other brucella strains can be specifically identified, detection on wild poisoning of brucella strains in farms immunized with the brucella A19 / S19 strain can be implemented, and purification, prevention and control on brucella diseases can be effectively implemented.

Description

technical field [0001] The invention relates to the technical field of pathogen detection, in particular to a DNA fragment, a primer and a detection method for distinguishing Brucella A19 / S19 strains from other strains. Background technique [0002] Brucellosis is a zoonotic infectious disease caused by Brucella, which is widely distributed all over the world, not only affecting the healthy development of animal husbandry, but also endangering human health. In recent years, the incidence rate has shown an upward trend year by year. [0003] At present, the main strategy for the prevention and control of animal brucellosis is quarantine and purification. The commonly used vaccine strains are mainly A19 / S19 vaccine strain and S2 vaccine strain. The M5 vaccine strain has also been used before, but it is rarely used now due to virulence. . The A19 and S19 vaccine strains are weak in virulence and reliable in immunity, and are currently widely used in cattle immunity. However,...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/689C12N15/11C12R1/01
CPCC12Q1/689
Inventor 刘宝山陈泽良沈国顺刘金玲韩小虎张欢杨博涵
Owner SHENYANG AGRI UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com