Application of miRNA30 cluster as diagnostic marker for Alzheimer's disease
A technology for Alzheimer's disease and hsa-mir-30a, applied in the direction of DNA/RNA fragments, recombinant DNA technology, microbial measurement/testing, etc., can solve the problem of no diagnostic markers for Alzheimer's disease
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0038] Example 1. miRNA high-throughput microarray technology detects differentially expressed microRNAs in the pathological process of AD
[0039] 1, 3, 6, and 9-month-old double transgenic mice (experimental group) and wild-type mice (control group) stably transfected with APP / PS1 gene were used. Utilizing the principle of Northern blotting, the high-throughput genomics expression profiling biochip technology of "high density, flexible customization, and micro-sample" is carried out, and the method of Trizol is used to extract RNA from mouse brain tissue and separate and label it. The embodiment of the present invention The microRNA of the miRNA 30 cluster is hsa-miR-30a, the sequence of which is shown in SEQ ID NO.1: gcgacuguaaacauccucgacuggaagcugugaagccacagaugggcuuucagucggauguuugcagcugc. Its default mature body (hsa-miR-30a-5p) sequence is shown in SEQ ID NO.2: gaaggucagcuccuacaaaugu. Among them, mature (hsa-miR-30a-5p) miRNA reverse transcription primer: SEQ ID NO.3: gtc...
Embodiment 2
[0041] The expression of the microRNA of embodiment 2, miRNA 30 clusters in AD model cell
[0042] Monoclonal strains were obtained by cell culture technology, liposome transient transfection, antibiotic pressurized screening, and limiting dilution method. At the same time, Western blot or ELISA was used for related protein detection to construct human neurons stably transfected with human-mouse chimeric APP gene. blastoma cells. At the same time, copper ions are used to induce the treatment of cells, copper ions form chelates with APP and Aβ, aggravate the production and deposition of Aβ, and induce oxidative stress response and apoptosis of nerve cells. Therefore, it is used to simulate the pathological state of AD nerve cells and the research on the mechanism of drug action.
[0043] RT-PCR and qPCR techniques were used for reverse transcription and real-time fluorescent quantitative detection of miR-30a expression changes in the pathological process of AD cell models. Su...
Embodiment 3
[0044] The expression of the microRNA of embodiment 3, miRNA 30 clusters in AD model animal
[0045] Double transgenic mice stably transfected with APP / PS1 gene (experimental group) and SAMP8 natural rapid aging mice (control group) were used. The hippocampus and cortex tissues of 1, 3, 6, and 9-month-old APP / PS1 double transgenic mice and SAMP8 natural rapid aging mice were extracted respectively, and the total mRNA of mouse cortex and hippocampus was extracted by Trizol method, and the concentration was determined by ultraviolet absorption method at the same time. and purity determination, using RT-PCR and qPCR techniques to detect the expression changes of miR-30a in the pathological process of AD.
[0046] Such as figure 2 In, B-C, in the cortex or hippocampus of the two animal models, compared with the same-month-old control mice (WTcontrol / SAMR8 mice), the expression levels of miR-30a were significantly different at 1, 3, 6, and 9 months of age A significant increase....
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


