Construction method and application of TOB1 gene knockout monoclonal cell line
A construction method and monoclonal technology, applied in the field of bioengineering, can solve problems such as trade barriers for animals and animal products, inability to suppress viruses, and effective control of epidemics, etc.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0045] Example 1 Construction of the monoclonal cell line TOB1-KOs with loss of TOB1 gene function
[0046] (1) Artificially synthesize the forward fragment and the reverse fragment of the sgRNA and anneal into a double-stranded fragment. The forward fragment of the sgRNA is 5'-CACCGCGTTTGGATCGACCCGTTTG-3' (shown in SEQ ID NO.2), and the reverse sequence is 5′-AAACCAAACGGGTCGATCCAAACGC-3′ (shown in SEQ ID NO.3); annealing system: 10×LA PCR Buffer II (Mg 2+ Plus) 5 μL, forward fragment (100 μM) 22.5 μL, reverse fragment (100 μM) 22.5 μL, mix gently; annealing program: 95°C, 2min; 95°C-85°C, 1°C / sec.
[0047] (2) connecting the double-stranded fragment with the pCRISPR-s4 vector after digestion with Bbs I, transforming the competent bacteria, and obtaining the TOB1 gene targeting vector PB-CRISPR;
[0048] When the wild-type IBRS-2 cells are in good condition and the confluence reaches 80%, refer to the instruction manual of the cell nuclear transfer kit, Cell line nucleofector...
Embodiment 2
[0051] Example 2 TOB1-KOs detection of FMDV RNA copy number and viral protein content after FMDV challenge
[0052] 1. Detection of total FMDV RNA copy number after TOB1-KOs challenged by FMDV
[0053] In this study, fluorescent probe method was used to detect the RNA copy number of FMDV in TOB1-KOs cells at 20hpi challenged by FMDV and in the culture supernatant at various time points by absolute quantitative PCR. After counting, take the same amount of wild-type IBRS-2 cells, Control library and two strains of TOB1-KOs (TOB1-KO1 and TOB1-KO2) and challenge them with FMDVA / GDMM (MOI=0.2) at the same time. control group), 4hpi, 8hpi, 12hpi, 16hpi, 20hpi, 24hpi, 32hpi, 40hpi, 48hpi, 56hpi and 64hpi time points to collect the mixture of cells and culture supernatants, extract viral RNA, and detect each sample by fluorescent probe absolute quantitative PCR The copy number of virus RNA (amplification primer FMDV3DqF: ACTGGGTTTTACAAACCTGTGA (shown in SEQ ID NO.6); FMDV 3D qR: GCGA...
Embodiment 3
[0059] Example 3 Determination of cell morphology and cell viability after TOB1-KOs challenged by FMDV
[0060] 1. Cell morphology of TOB1-KOs challenged by FMDV
[0061] After cell counting, the same amount of wild-type IBRS-2 cells, Control library, and two strains of TOB1-KOs (TOB1-KO1 and TOB1-KO2) were simultaneously challenged with FMDV A / GDMM (MOI=0.2), and each group of cells was subjected to FMDV During the challenge, the cells in a culture dish were kept as a control (Mock), and the serum-free DMEM medium was changed when the experimental group was challenged with FMDV, and the cell pathological changes were observed and recorded with the EVOS cell imager at 12hpi and 24hpi respectively, and the results Such as Image 6 As shown, wild-type IBRS-2 cells and Control library had early CPE due to FMDV infection, and some cells changed from irregular polygonal adherent morphology to round shape; while TOB1-KOs (TOB1-KO1 and TOB1-KO2) cells The morphology was not affecte...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More