51 results about "Resistant phenotype" patented technology

The invention relates to the field of cucumber disease-resistant breeding analysis, in particular to a disease-resistant gene typing result analysis method and system, which are applied to a cucumber disease-resistant breeding analysis environment, and the method comprises the following steps: obtaining multi-source heterogeneous microscopic phenotype data for cucumber disease-resistant breeding analysis, the multi-source heterogeneous microscopic phenotype data is converted into a unified quantitative index set; multi-source heterogeneous microscopic phenotype data is converted into a unified quantitative index set, and a plurality of resistance components are identified through data dimension reduction processing based on the unified quantitative index set, so that complex microscopic resistance responses are abstracted into quantifiable component feature vectors; the feature vector is further subjected to correlation analysis with genotyping data and macroscopic disease-resistant phenotype data, so that the problem that microscopic data and a resistance mechanism are difficult to effectively integrate and reveal in the prior art is solved, and the effects of deeply understanding the disease-resistant mechanism and realizing mechanism-based precise breeding are achieved.

The invention belongs to the technical field of biology, and particularly relates to application of hepcidin expression quantity in larimichthys crocea liver as larimichthys crocea visceral white-spot disease resistance evaluation index and a construction method. The hepcidin expression quantity in the larimichthys crocea liver is applied as the larimichthys crocea visceral white-spot disease resistance evaluation index. The construction method of the resistance evaluation index comprises the following steps: taking healthy small yellow croaker intraperitoneal injection pseudomonas proteinus strain bacterial liquid, and determining a half lethal dose in 96 hours; the method comprises the following steps: injecting a half lethal dose of bacterial liquid of pseudomonas proteinus strains into the abdominal cavity of healthy small yellow croaker for 96 hours, and after infection, taking different tissues to carry out hepcidin gene expression fluorescent quantitative PCR analysis; a regression model of gene expression quantity and bacterium loading quantity is established through fluorescence quantification, and the relationship between hepcidin expression quantity and disease resistance is constructed. Accurate disease-resistant phenotype information is provided for development of breeding of visceral white-spot disease-resistant improved varieties of the small yellow croakers, the accuracy of disease-resistant breeding is promoted, early detection of diseases is realized, and prevention and treatment of the diseases are effectively guided.

The invention provides a breeding method of hypoxia-resistant golden tiger hybrid spots, which comprises the following steps: carrying out artificial insemination on a female parent of epinephelus coioides and a male parent of epinephelus coioides to obtain fertilized eggs, carrying out 2.8-3.2 mg / L hypoxia screening on the female parent for more than three generations, and ensuring that the suffocation point is less than or equal to 0.9 mg / L. Performing staged low-oxygen incubation on the fertilized eggs, gradually reducing dissolved oxygen in an embryonic period, a protointestinal period and a membrane emergence period, performing specific sound wave stimulation in an opening period of larva fish, performing low-oxygen-resistant phenotype screening in a larva period, performing intermittent low-oxygen intensive training in a juvenile fish period, applying water flow stimulation before training, and performing low-oxygen-resistant phenotype screening in a membrane emergence period; during the period, a fortified feed containing gamma-aminobutyric acid, heme iron and other components is fed. According to the method, through multi-link collaborative innovation, the hypoxia resistance of the Jinhu hybrid spots is effectively improved, the survival rate of a target group under 2.5 mg / L dissolved oxygen reaches 93%, the suffocation point is reduced to 0.75 mg / L, meanwhile, gill filament development and growth are promoted, and an efficient technical scheme is provided for aquatic product breeding.

The invention discloses a multifunctional composite microbial inoculant for improving drought resistance of plants as well as a preparation method and application of the multifunctional composite microbial inoculant, and belongs to the field of microbiology. According to the multifunctional composite microbial inoculant, by establishing a culture medium with gradually increased PEG (Polyethylene Glycol) concentration, progressive drought resistance induction is carried out on a known functional strain, so that the strain damage caused by single high-intensity stress is effectively avoided, and the strain can still keep relatively high activity and stability under a drought condition; progressive drought-resistant induction enables the strain to gradually adapt to the drought environment, so that the drought resistance of the strain is enhanced, the survival rate of the strain under the drought condition is increased, and the strain can better play a role in drought resistance and growth promotion; the multifunctional composite microbial inoculant is applied to plant seedling root system field planting, stress resistance phenotype induction and ecological adaptability improvement in arid / semi-arid regions, the colonization survival rate of seedling rhizosphere of caragana microphylla is increased to 2.3 times of that of conventional treatment, the transplanting survival rate of caragana microphylla is increased to 78% from 42%, and the multifunctional composite microbial inoculant has wide application prospects.

Provided are methods and compositions for enhancing radiotherapy in various cancers by administering dopamine receptor (DRD2)‐binding phenylpiperazine derivatives such as brexpiprazole, cariprazine, pipamperone, and perospirone. In vitro studies show that combining these agents with ionizing radiation (e.g., 5 Gy) significantly reduces cancer cell survival, suppresses metastatic and stemness markers (e.g., CD44, MMP‑2, Snail, Nanog), and promotes apoptosis. Fractionated or single‐fraction radiation regimens can be paired with DRD2 antagonists to lower treatment‐resistant phenotypes, decrease the likelihood of recurrence, and potentially reduce necessary radiation dosages. The approach applies to breast, prostate, lung, pancreatic, and brain cancers, among others. Depending on tumor characteristics, additional chemotherapeutic or immunotherapeutic agents may further improve outcomes.

The application relates to a mycobacterium tuberculosis drug resistance phenotype prediction method and device and a computer device. The method comprises the following steps: determining a to-be-predicted mutation site which does not exist in a mutation phenotype annotation database from at least one mutation site of a target gene fragment of to-be-processed mycobacterium tuberculosis according to gene sequencing data of the mycobacterium tuberculosis; converting protein structure change data of the to-be-predicted mutation site according to protein structure data corresponding to the to-be-predicted mutation site; inputting the protein structure change data of the to-be-predicted mutation site into a drug resistance phenotype prediction model to obtain a predicted drug resistance phenotype of the to-be-predicted mutation site; and determining a drug resistance phenotype prediction result of the to-be-processed mycobacterium tuberculosis based on the predicted drug resistance phenotype of the to-be-predicted mutation site and drug resistance phenotypes of the mutation sites except the to-be-predicted mutation site. The method can effectively improve the mycobacterium tuberculosis drug resistance phenotype prediction efficiency.

The present invention belongs to the technical field of molecular markers and germplasm resource identification, and in particular to Indel molecular markers for identifying drought resistance of upland cotton and their applications. The Indel molecular marker is located at the 737th base of the nucleotide sequence shown in SEQ ID NO.1. In drought-resistant cotton germplasm, the genotype of the Indel molecular marker is G, and in drought-sensitive cotton germplasm, the genotype of the Indel molecular marker is GGATATCAAAATTTTAATCCGTATTATCTAATTGC CTAATAAAAGGA. The Indel molecular marker provided by the present invention is closely linked to the drought-resistant phenotype of upland cotton, can be used for efficient and accurate identification or auxiliary identification of the drought resistance of the cotton to be tested, effectively distinguish between drought-resistant and drought-sensitive cotton germplasm, and provide effective means and approaches for the assisted selection of drought-resistant cotton and the cultivation of new cotton germplasm resources through molecular markers.

The invention discloses a carbapenem drug resistance marker screening method and system based on a cross-species compressed Debrueine diagram and a medium. The method comprises the following steps: starting from whole genome sequencing data of gram-negative bacteria belonging to different species and carbapenem drug phenotypes of the gram-negative bacteria, constructing a compressed Debrueine graph based on cross-species joint data, and taking existence / deletion of nodes in the graph as unified genetic variation characteristics. Performing correlation analysis on the nodes and the drug resistance phenotypes by using a linear hybrid model to obtain a candidate node set related to the phenotypes; k-mer is extracted based on the candidate node sequence, and secondary statistical screening is completed in combination with chi-square test and mutual information; and finally determining a group of carbapenem drug-resistant genetic markers which can be applicable across species through a hierarchical feature selection strategy of random forest and XGBoost. Efficient dimension reduction of large-scale cross-species genome data, cross-species consistent variation representation and high-interpretability marker screening are achieved.

The invention belongs to the technical field of biological medicines, and particularly relates to application of an HS2ST1 inhibitor in preparation of a medicine for treating KRAS inhibitor drug-resistant tumors. At present, more than 50% of KRAS inhibitor drug-resistant patients have unclear mechanisms and lack of effective intervention targets, and HS2ST1 is identified as a key regulation target of KRAS inhibitor drug resistance for the first time. Researches find that the expression of HS2ST1 in KRAS inhibitor drug-resistant cells is significantly up-regulated; functional experiments prove that targeted intervention of the HS2ST1 can effectively enhance the curative effect of the KRAS inhibitor and reverse the drug resistance phenotype of the KRAS inhibitor, and a new strategy and a potential treatment direction are provided for overcoming KRAS targeted treatment drug resistance.

The invention discloses an application of PINK1 in regulation and control of ER positive breast cancer tamoxifen drug resistance. The invention relates to application of PINK1 as a biomarker in evaluating the tamoxifen resistance of ER positive breast cancer cells. The drug resistance is evaluated by detecting the expression level of PINK1 in a sample and combining mitochondrial autophagy activity. The expression level of the PINK1 comprises an mRNA level and / or a protein level. According to the invention, the drug resistance formation process is systematically analyzed from the perspective of quality control of an organelle of mitochondrial autophagy, and through public database analysis and experimental verification, the overall up-regulation of the mitochondrial autophagy pathway in drug-resistant cells is clearly revealed, and the drug-resistant phenotype is promoted by maintaining the mitochondrial steady state, thereby opening up a new direction for understanding the drug-resistant mechanism.

The invention relates to the technical field of molecular biology, in particular to application of an MEB2 gene in negative regulation of sclerotiniose resistance of plants. Whole genome correlation analysis is carried out to identify that the site of the BnMEB2 gene is a sclerotiniose resistance key regulation site in a natural rape population, and meanwhile, arabidopsis thaliana meb2 mutant, overexpression and BnMEB2 susceptible haplotype are utilized to prove that the disease resistance of plants can be improved due to MEB2 function deficiency, the susceptibility is enhanced due to overexpression, and the BnMEB2 gene can be used as the sclerotiniose resistance key regulation site. And a dose effect relationship between gene expression and disease-resistant phenotype is established. The invention discloses a variable shear transcript AtMEB2.2 of an arabidopsis MEB2 gene. An overexpression experiment shows that the transcript significantly enhances sclerotinia sclerotiorum susceptibility. Besides, a haplotype typing method is developed aiming at 16 SNP loci in the rape BnMEB2 gene region, and the haplotype typing method has an important application prospect in rapid screening of disease-resistant phenotypes.

The invention discloses an Indel molecular marker related to the browning character of towel gourd pulp, a detection primer and application of the Indel molecular marker and the detection primer, and belongs to the field of molecular assisted genetic breeding. The Indel molecular marker is located at the 8045208 site of the No. 5 chromosome of a luffa cylindrica reference genome, the site has a 15bp insertion / deletion variation, and the genotype (homozygous insertion type / heterozygous vs. Homozygous deletion type) is highly consistent with the browning-resistant phenotype. A detection primer pair developed on the basis of the marker can accurately predict the browning characteristic of the fruit of the towel gourd through DNA detection in the early growth stage of the towel gourd, and transformation from phenotype selection to genotype selection is achieved. The invention provides a brand-new, accurate and reliable molecular tool for browning-resistant breeding of towel gourds.

The invention discloses a sensitizing drug for resisting breast cancer by radiotherapy and a screening method and application thereof, and belongs to the field of biomedicine.The method comprises the steps that an in-vitro radiotherapy resistance model is constructed, a clinical segmentation radiotherapy dose increasing mode is simulated, stable acquired radiotherapy resistance is induced to be generated, and a carrier is provided for drug screening; natural plant small molecule compounds are used for treatment, and through concentration and time gradient dual control, the reversion ability of the natural plant small molecule compounds to radiotherapy resistance phenotypes is investigated; a multi-dimensional joint detection system is established, multi-level comprehensive evaluation is performed from cell survival and the like, the limitation of a single index is broken through, and the screening accuracy and reliability are improved; dNA damage repair is dynamically monitored through immunofluorescence, comet electrophoresis and the like, and the drug action mechanism is revealed. The medicine screened by the method is suitable for primary and acquired radiotherapy resistance patients, can effectively improve the radiotherapy curative effect, provides a new medicine source and scheme for clinical problems, and opens up the application of the compound in preparation of radiosensitizers or adjuvant therapy medicines.

The present invention relates to the field of biotechnology, and in particular to an Indel molecular marker related to drought resistance of upland cotton, as well as a method and application thereof. The Indel molecular marker is located at bases 1083-1100 of the nucleotide sequence shown in SEQ ID NO: 1. In drought-resistant cotton germplasm, the genotype of the Indel molecular marker is CAGCGAAAAACTAAGTGT, and in drought-sensitive cotton germplasm, the genotype of the Indel molecular marker is C. The Indel molecular marker provided by the present invention is closely linked to the drought-resistant phenotype of upland cotton, can be used to efficiently and accurately identify or assist in identifying the drought resistance of tested cotton, effectively distinguish between drought-resistant and drought-sensitive cotton germplasm, and provide an effective means and approach for molecular marker-assisted selection of drought-resistant cotton and cultivation of new cotton germplasm resources.

The invention discloses an organoid transcriptome-based RAF co-mutation drug resistance mechanism analysis method, and belongs to the technical field of biomedicine. The method comprises the following steps: collecting and standardizing multi-source heterogeneous organoid transcriptome data, and constructing a dynamic detection timeline covering the whole process of organoid culture and drug treatment; defining dynamic expression characteristics and three core sets of RAF co-mutation, differential expression genes and drug-resistant phenotypes based on a time window; analyzing a dynamic regulation and control relationship among the three by utilizing a basic inference rule set driven by literatures, calculating an analysis weight by counting the locking times of a time window, quantitatively evaluating the analysis effectiveness and endowing a state value; and finally, by constructing an analysis state matrix, mining analysis relevancy among different detection events, and screening an optimal related analysis object. According to the method, the problems of static analysis, fuzzy regulation and control relationship and the like in the traditional drug resistance mechanism research are solved, and the dynamic, accurate and efficient analysis of the RAF comutation drug resistance mechanism is realized.

The invention belongs to the technical field of bioengineering, particularly relates to a papaya CpWRKY57 gene, and further discloses application of the CpWRKY57 gene in the fields of improving papaya anthracnose resistance and promoting plant dwarfing. According to the scheme, the CpWRKY57 gene is separated from papaya leaves for the first time, a CpWRKY57 instantaneous overexpression vector and a CpWRKY57 stable overexpression vector are constructed, postharvest papaya fruits and tomato explants are instantaneously converted respectively, instantaneous overexpression of the CpWRKY57 gene in the papaya fruits and heterologous overexpression of the CpWRKY57 gene in the tomatoes are achieved, and the CpWRKY57 gene can be applied to the field of genetic engineering. According to the invention, the CpWRKY57 gene is used as a marker, disease-resistant phenotype analysis is carried out through needling inoculation of colletotrichum gloeosporioides, the effect of the CpWRKY57 gene in the process of resisting anthracnose of papaya and the function of promoting plant dwarfing are defined, and a new gene resource and a theoretical basis are provided for disease-resistant and dwarfing breeding of papaya.

The invention relates to the technical field of plant genetic engineering, in particular to application of ZmAHA1 protein and a coding gene thereof in regulation and control of heat stress resistance of corn, through overexpression of ZmAha1 gene in corn, it is determined that an overexpressed plant has obvious high-temperature-resistant phenotype, it is verified that the corn ZmAha1 gene can positively regulate and control plant heat resistance, and through the expression quantity of the overexpressed ZmAha1 gene, the corn ZmAha1 gene can positively regulate and control plant heat stress resistance. The heat resistance of plants can be effectively improved. The discovery of the heat-resistant function of the ZmAha1 gene provides a new gene target and resource for cultivating heat-resistant plant varieties, has important significance on research on a heat-resistant molecular mechanism of corn, and lays a certain theoretical foundation for research on a high-temperature stress response mechanism and a molecular mechanism for resisting adverse environments of plants.

The invention belongs to the technical field of microorganisms, and particularly relates to Escherichia coli MZ2014 with sustainable phenotypic heterogeneity and heterogeneity drug resistance characteristics and application of the Escherichia coli MZ2014. The MZ2014 strain can be continuously and stably differentiated into two forms of a large bacterial colony (MZ2014-B) and a small bacterial colony (MZ2014-S) under conventional culture conditions, and the two subgroups show a clear heterogeneity drug-resistant phenotype: the MZ2014-B is shown as a medium for ertapenem, and the MZ2014-S is shown as sensitivity. Further researches show that the two subgroups have significant differences in cellular morphology, growth rate and athletic ability. Therefore, the MZ2014 strain provided by the invention is not only a precious model for researching phenotypic heterogeneity and non-hereditary drug resistance mechanisms, but also can be used as a key tool for screening active substances capable of overcoming heterogeneity drug resistance or inhibiting phenotypic differentiation, and has important scientific research value and application prospect.

The present invention relates to the field of molecular biotechnology, and particularly to the application of the MEB2 gene in negatively regulating the resistance of plants to Sclerotinia sclerotiorum. Through genome-wide association analysis, the present invention identifies the locus where the BnMEB2 gene is located as a key regulatory locus for Sclerotinia sclerotiorum resistance in the rapeseed natural population. At the same time, using the Arabidopsis meb2 mutant, overexpression, and the BnMEB2 susceptible haplotype, it is confirmed that the loss of MEB2 function can enhance the disease resistance of plants, while overexpression leads to enhanced susceptibility, establishing a dose-effect relationship between gene expression and disease-resistant phenotypes. The present invention discloses the alternative splicing transcript AtMEB2.2 of the Arabidopsis MEB2 gene, and overexpression experiments show that this transcript significantly enhances the susceptibility to Sclerotinia sclerotiorum. In addition, the present invention develops a haplotype typing method for 16 SNP loci in the BnMEB2 gene region of rapeseed, which has important application prospects in the rapid screening of disease-resistant phenotypes.

The application discloses SNP sites for identifying upland cotton high-temperature-resistant germplasm and application thereof, belongs to the technical field of molecular biology detection, and provides SNP sites for identifying upland cotton high-temperature-resistant germplasm, wherein the SNP sites are SNP1 and SNP2; SNP1 is located at the 42577154th position on the D12 chromosome of upland cotton, and the nucleotide is T / C; and SNP2 is located at the 42577814th position on the D12 chromosome of upland cotton, and the nucleotide is A / T. The application also provides application of the SNP sites in preparation of products for identifying upland cotton high-temperature-resistant germplasm. The application provides two SNP sites linked with the pollen high-temperature-resistant phenotype of upland cotton and PCR primers for detection, enriches high-temperature-resistant gene resources of upland cotton, and accelerates the breeding process of upland cotton.

The application discloses a soybean low-temperature-resistant transcription factor gene GmBZR4 and application thereof, and belongs to the technical field of plant genetic engineering and molecular breeding. GmBZR4 The nucleotide sequence of the gene is shown as SEQ ID NO. 1. GmBZR4 The application clones a gene in a soybean variety Williams 82, constructs an overexpression vector, and transforms the vector into Arabidopsis thaliana, and through low-temperature-resistant phenotype identification, it is proved that overexpression of the gene can significantly improve the low-temperature-resistant adaptability of Arabidopsis thaliana at the seedling stage and the germination stage. GmBZR4 The survival rate of the unacclimatized overexpression strain after treatment at-8 DEG C is up to 81% (7% for the wild type), and the germination speed is significantly faster than that of the wild type under a low-temperature environment. GmBZR4 The gene provided by the application can be used as a target gene resource and applied to the cultivation of low-temperature-resistant plant varieties, and especially provides key technical support for soybean low-temperature-resistant molecular breeding.

The invention belongs to the technical field of biological medicines, and particularly relates to application of daptomycin in preparation of a non-small cell lung cancer KRAS G12C inhibitor drug resistance reversal agent. It is found that the problem of drug resistance of non-small cell lung cancer to a KRAS inhibitor can be solved through combination of daptomycin and adagraxib, an excellent anti-tumor effect is shown, the drug resistance phenotype mediated by an acquired drug resistance mechanism can be remarkably reversed, no obvious toxic or side effect is observed in an experimental animal body, and the safety characteristic is good. In order to overcome the problem of drug resistance of targeted drugs such as KRAS inhibitors, the invention provides a novel combined treatment solution with high efficiency and safety.

The invention provides application of a tomato SlMT5 gene in improving high temperature stress resistance of plants, and belongs to the technical field of plant genetic engineering.Experiments show that under high temperature stress, an overexpressed plant containing the SlMT5 gene shows remarkably enhanced heat-resistant phenotype compared with a wild type, specifically, the withering degree and the heat damage index of the plant are remarkably reduced, and the heat-resistant phenotype of the overexpressed plant containing the SlMT5 gene is remarkably improved. The relative water content of the leaves is obviously increased. Meanwhile, the overexpressed plant can better maintain the photosynthesis capacity, and the maximum photochemical efficiency (Fv / Fm) and chlorophyll content of the overexpressed plant are remarkably higher than those of a wild type. In the aspect of oxidation resistance, the activity of antioxidant enzymes (SOD, POD and CAT) of overexpressed plants is remarkably enhanced, accumulation of active oxygen (and) and membrane lipid peroxidation products (MDA) is remarkably reduced, and the content of osmotic regulation substances (proline, ascorbic acid and soluble sugar) is remarkably increased; the invention provides key gene resources and technical support for cultivating new varieties of high-temperature-resistant crops.

The invention relates to the technical field of bioinformatics, and particularly discloses a method for screening drug resistance variation characteristics of bacteria based on a whole genome level and application. According to the method, a machine learning prediction model is established by using a method for associating variation detection and drug resistance characteristics in a whole genome range, the correlation between variation of genes in a coding region and a drug resistance phenotype is considered, and the correlation between variation of a non-coding region and a drug resistance phenotype is also considered, so that the method is more comprehensive; meanwhile, during screening of variation sites, a threshold value is set, the biological significance of the sites is considered and compared, and the result is more reliable and accurate.

The invention discloses a method for detecting drug resistance of acute myelogenous leukemia by WDR4 and an intelligent detection kit, relates to the technical field of acute myelogenous leukemia detection, and aims to solve the problem of poor drug resistance detection effect of acute myelogenous leukemia. Through linkage detection of WDR4 gene, protein expression and drug resistance phenotype, a gene-protein-function complete evidence chain is formed, limitation of a single index is avoided, drug resistance judgment reliability is improved, accurate targets are provided for analysis of acute myelogenous leukemia drug resistance mechanism, linkage detection of WDR4 gene, protein expression and drug resistance phenotype is realized, and drug resistance of acute myelogenous leukemia is improved. A'gene-protein-function 'complete evidence chain is formed, the limitation of a single index is avoided, the drug resistance judgment reliability is improved, and a precise target spot is provided for analyzing the drug resistance mechanism of acute myelogenous leukemia.

The invention discloses a trachinotus ovatus cold-resistant variety breeding assisting method and system based on scene adaptation, and the method comprises the steps: obtaining breeding environment scene data, individual genotype data and individual low-temperature-resistant phenotype data of trachinotus ovatus bred in winter in different sources, and constructing a multi-scene breeding database; screening out a candidate SNP site set significantly related to the low temperature resistance phenotype, and constructing a fusion feature vector representing a genotype-environment interaction effect; taking the fusion feature vector as a decision variable, taking low-temperature-resistant phenotypic data as a target variable, and combining with a multi-scene breeding database to construct a cold-resistant performance prediction model; acquiring expected breeding scene information, simulating and generating a virtual breeding group in combination with an existing germplasm resource library, and performing dominant genotype recommendation to obtain a dominant genotype recommendation table; candidate parent individuals are screened in combination with the current available parent group, a breeding path is designed, an optimal breeding scheme is generated and pushed, and precise adaptive breeding of the variety and the target breeding scene is achieved.

The invention discloses synthesis of a novel plant growth regulator and application of the novel plant growth regulator in improvement of crop stress resistance, and relates to the field of agricultural biology. The composition is composed of the following components in parts by weight: 10-20 parts of sodium alginate oligosaccharide; 30 to 50 parts of a functionalized polydopamine nano carrier PDA (at) Ce; 5 to 10 parts of yeast source defense peptide YDP-125; the chelating auxiliary agent comprises 2-5 parts of naphthylacetic acid potassium salt and 3-8 parts of fulvic acid. The synergistic effect of all the components is utilized, the sodium alginate oligosaccharide is used for activating an ethylene signal channel and starting stress-resistant gene expression, the yeast source defense peptide YDP-12 is used for simulating phytophyton, biosynthesis of jasmonic acid is stimulated, protein accumulation of PR-2 and PR-3 is promoted, virus resistance is enhanced, PDA at Ce is chelated with nutrients through phenolic hydroxyl groups, ROS response type cerium ion release is achieved, Fenton reaction is catalyzed, and the effect of improving stress resistance is achieved. The. OH is converted into H2O2; chelated Zn < 2 + > and Mn < 2 + > enhance the SOD activity, so that the content of membrane lipid peroxidation markers is reduced; fulvic acid and sodium alginate oligosaccharide form a complex, DNA methylation modification is continuously induced, and stress resistance phenotype maintenance is promoted.

The application belongs to the technical field of biological medicine and molecular biology, and particularly relates to application of lactylation modified PARP1-K548 in glioma drug resistance diagnosis, prognosis analysis and treatment. Specifically, through in-depth research on the GBM TMZ drug resistance formation mechanism, the application finds that the lactylation modified PARP1-K548 signal shaft plays a key role in maintaining the drug resistance phenotype, and further provides related application of the lactylation modified PARP1-K548 in glioma drug resistance diagnosis, prognosis analysis and treatment, and therefore has good practical application value.

The application discloses a rice drought-resistant phenotype analysis method based on multi-task deep learning, relates to the technical field of crop phenotype analysis, computer vision and artificial intelligence, and specifically comprises the following steps: acquiring multi-time-phase RGB images of rice by using a high-throughput platform; extracting features by using a visual Transformer model; constructing color and morphological physiological branches and decoupling; constructing a physiological space based on agronomic traits and projecting features; constructing a multi-task network to optimize features; applying time sequence constraints to optimize features; and finally identifying drought-resistant genetic loci through whole-genome association analysis, realizing a closed loop of phenotype analysis and gene mining; by integrating multi-view images, deep feature decoupling and physiological space alignment technologies, the application constructs a multi-task framework, accurately separates color and morphological changes caused by drought, and improves the comprehensiveness of phenotype analysis; dynamic features are optimized in combination with time sequence constraints, and phenotype-genotype correlation is strengthened through whole-genome association analysis, so that the efficiency of drought-resistant genetic loci mining is significantly improved.

The invention relates to a primer and probe combination for simultaneously detecting urinary tract klebsiella pneumoniae and drug-resistant genes through nested PCR (Polymerase Chain Reaction) and a kit of the primer and probe combination, which can solve the problem that the existing detection target lpxC of klebsiella pneumoniae is highly homologous with the sequence alignment of part of related bacteria (klebsiella oxytoca, enterobacter aerogenes and citrobacter freundii); based on the defect that a primer and probe combination designed by an existing target lpxC causes cross amplification of the bacteria and does not meet clinical requirements, and the situation that a combination of a drug-resistant gene mecA and klebsiella pneumoniae is not suitable for clinical scenes, by simultaneously identifying the klebsiella pneumoniae and common drug-resistant genes of the two bacteria, the drug-resistant genes of the two bacteria can be identified, and the drug-resistant genes of the two bacteria can be identified. The Klebsiella pneumoniae gene, namely a carbapenemase-producing drug-resistant gene KPC-2 and an extended-spectrum beta-lactamase-producing drug-resistant gene (ESBL) CTX-M-15, can be used for judging whether the Klebsiella pneumoniae is sensitive or drug-resistant Klebsiella pneumoniae and distinguishing specific drug-resistant phenotypes, so that more comprehensive and definite medication guidance can be provided for clinicians.