Method for constructing a mouse B-cell lymphoma A20-hCD20(Tg)-mCD20(KO)-Luciferase cell line capable of stably expressing luciferase and human CD20 and knocking out mouse CD20

A luciferase, stable expression technology, applied in the field of cell engineering, can solve problems such as inability to meet

Active Publication Date: 2020-09-25
GEMPHARMATECH CO LTD
View PDF3 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] The existing preclinical animal tumor modeling models cannot meet the requirements of having a sound immune system and can directly evaluate the anti-tumor effect of CD20 human antibody by acting on human CD20 protein

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for constructing a mouse B-cell lymphoma A20-hCD20(Tg)-mCD20(KO)-Luciferase cell line capable of stably expressing luciferase and human CD20 and knocking out mouse CD20
  • Method for constructing a mouse B-cell lymphoma A20-hCD20(Tg)-mCD20(KO)-Luciferase cell line capable of stably expressing luciferase and human CD20 and knocking out mouse CD20
  • Method for constructing a mouse B-cell lymphoma A20-hCD20(Tg)-mCD20(KO)-Luciferase cell line capable of stably expressing luciferase and human CD20 and knocking out mouse CD20

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0079] Example 1 Construction of a transgenic plasmid stably expressing luciferase and human CD20

[0080] Select human CD20 gene CDS sequence (SEQ No.1) and Luciferase gene (SEQ No.2) according to figure 1 The strategy shown is to construct the transgenic vector GPT000292-3-dsDNA-hCD20-TG, and the plasmid map is as follows figure 2 shown.

[0081] :ATGACAACACCCAGAAATTCAGTAAATGGGACTTTCCCGGCAGAGCCAATGAAAGGCCCTATTGCTATGCAATCTGGTCCAAAACCACTCTTCAGGAGGATGTCTTCACTGGTGGGCCCCACGCAAAGCTTCTTCATGAGGGAATCTAAGACTTTGGGGGCTGTCCAGATTATGAATGGGCTCTTCCACATTGCCCTGGGGGGTCTTCTGATGATCCCAGCAGGGATCTATGCACCCATCTGTGTGACTGTGTGGTACCCTCTCTGGGGAGGCATTATGTATATTATTTCCGGATCACTCCTGGCAGCAACGGAGAAAAACTCCAGGAAGTGTTTGGTCAAAGGAAAAATGATAATGAATTCATTGAGCCTCTTTGCTGCCATTTCTGGAATGATTCTTTCAATCATGGACATACTTAATATTAAAATTTCCCATTTTTTAAAAATGGAGAGTCTGAATTTTATTAGAGCTCACACACCATATATTAACATATACAACTGTGAACCAGCTAATCCCTCTGAGAAAAACTCCCCATCTACCCAATACTGTTACAGCATACAATCTCTGTTCTTGGGCATTTTGTCAGTGATGCTGATCTTTGCCTTCTTCCAGGAACTTGTAATAGCTGGCATCGTTGA...

Embodiment 2

[0095] Example 2 Construction of sgRNA for mouse CD20 knockout

[0096] In order to prevent human CD20 and CD20 of mouse cell lines from having homologous regions, the design of sgRNA needs to avoid the exon of the gene, and at the same time, consider improving the knockout efficiency. The sgRNA cuts the donor. sgRNA is designed at the 3' end of exon7 to screen cell clones with frameshift mutations, and the mouse CD20 knockout strategy is as follows Figure 5 shown.

[0097] According to CRISPR Cas9 technology, two sgRNAs were designed at the 5' end of mouse CD20 exon1 and the 3' end of exon7 respectively. Specific steps are as follows:

[0098] (1) Synthesize the upstream and downstream primers of sgRNA respectively, and the primer purification method is PAGE, and the primer sequences are shown in Table 4;

[0099] Table 4 Primer list for sgRNA construction

[0100]

[0101] (2) The upstream and downstream primers of sgRNA were diluted to 100 umol / ul, mixed at a ratio ...

Embodiment 3

[0110] Example 3. Construction and identification of A20-hCD20(Tg)-mCD20(KO)-Luciferase cell line

[0111] 1. Construction of A20-hCD20(Tg)-mCD20(KO)-Luciferase cell line

[0112] (1) Determination of the optimal working concentration for G418 resistance screening

[0113] A20 cells were cultured in 1640 medium containing 10% fetal bovine serum at 37°C in 5% CO 2 ; A20 cells in the logarithmic growth phase were taken, and the cell concentration was adjusted to 1×10 5 / mL, 1×10 5 Cells were inoculated into each well of a 24-well plate and cultured overnight, and Neo-resistant G418 was diluted to obtain 9 gradients of 0-800 μg / mL, which were added to the 24-well plate for resistance pressure screening, and one replicate well was set for each concentration. Follow up to observe the growth of A20 cells. The lowest concentration of G418 that can cause all cells to die within 5-7 days is the optimal working concentration of 400 μg / mL for screening and transfecting A20 cells.

[...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention relates to a method for constructing a mouse B-cell lymphoma A20-hCD20(Tg)-mCD20(KO)-Luciferase cell line capable of stably expressing luciferase and human CD20. According to the cell line, co-transformation into an A20 cell line is carried out on a transgenic plasmid with Luciferase and human CD20 genes and sgRNA with knockout of mouse CD20 genes through electrotransformation so asto obtain the A20 cell line capable of stably expressing the human CD20 and luciferase and knocking out the mouse CD20 genes of the cell line. Screening is performed through a Neo resistance elementon the transgenic plasmid so as to obtain a stable and hereditary monoclone, so that stable expression of the luciferase and human CD20 gene and knockout of the mouse CD20 genes are achieved; and through the cell line, a measurable and visual model is provided for evaluation of the efficacy of drugs for targeting CD20 in the mouse body.

Description

technical field [0001] The invention belongs to the technical field of cell engineering, and relates to the construction of mouse B-cell lymphoma A20 cell line, especially mouse B-cell lymphoma A20-hCD20 ( Construction method of Tg)-mCD20(KO)-Luciferase cell line. Background technique [0002] Lymphoma is one of the top ten most common malignant tumors that occur in the lymphatic system in the world. Its incidence in China also shows a trend of increasing year by year, ranking among the top ten in the incidence of malignant tumors, and the death rate is at the forefront. Lymphoma in clinical practice is characterized by complex classification and high heterogeneity, and is mainly divided into non-Hodgkin's lymphoma (diffuse B-cell lymphoma, mantle cell lymphoma, indolent lymphoma) and Hodgkin's lymphoma , different types of lymphoma have different clinical treatment strategies, among which CD20, as a transmembrane protein expressed on the surface of malignant B lymphocytes,...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/90C12N15/85C12N5/10C12Q1/02C12R1/91
CPCC07K14/70596C12N5/0635C12N5/0693C12N9/0069C12N15/85C12N15/907C12N2503/02C12N2510/00G01N33/5011G01N33/5052G01N2333/70596G01N2500/10
Inventor 赵静琚存祥于薇薇鞠超
Owner GEMPHARMATECH CO LTD
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap