Method for constructing a mouse B-cell lymphoma A20-hCD20(Tg)-mCD20(KO)-Luciferase cell line capable of stably expressing luciferase and human CD20 and knocking out mouse CD20
A luciferase, stable expression technology, applied in the field of cell engineering, can solve problems such as inability to meet
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0079] Example 1 Construction of a transgenic plasmid stably expressing luciferase and human CD20
[0080] Select human CD20 gene CDS sequence (SEQ No.1) and Luciferase gene (SEQ No.2) according to figure 1 The strategy shown is to construct the transgenic vector GPT000292-3-dsDNA-hCD20-TG, and the plasmid map is as follows figure 2 shown.
[0081] :ATGACAACACCCAGAAATTCAGTAAATGGGACTTTCCCGGCAGAGCCAATGAAAGGCCCTATTGCTATGCAATCTGGTCCAAAACCACTCTTCAGGAGGATGTCTTCACTGGTGGGCCCCACGCAAAGCTTCTTCATGAGGGAATCTAAGACTTTGGGGGCTGTCCAGATTATGAATGGGCTCTTCCACATTGCCCTGGGGGGTCTTCTGATGATCCCAGCAGGGATCTATGCACCCATCTGTGTGACTGTGTGGTACCCTCTCTGGGGAGGCATTATGTATATTATTTCCGGATCACTCCTGGCAGCAACGGAGAAAAACTCCAGGAAGTGTTTGGTCAAAGGAAAAATGATAATGAATTCATTGAGCCTCTTTGCTGCCATTTCTGGAATGATTCTTTCAATCATGGACATACTTAATATTAAAATTTCCCATTTTTTAAAAATGGAGAGTCTGAATTTTATTAGAGCTCACACACCATATATTAACATATACAACTGTGAACCAGCTAATCCCTCTGAGAAAAACTCCCCATCTACCCAATACTGTTACAGCATACAATCTCTGTTCTTGGGCATTTTGTCAGTGATGCTGATCTTTGCCTTCTTCCAGGAACTTGTAATAGCTGGCATCGTTGA...
Embodiment 2
[0095] Example 2 Construction of sgRNA for mouse CD20 knockout
[0096] In order to prevent human CD20 and CD20 of mouse cell lines from having homologous regions, the design of sgRNA needs to avoid the exon of the gene, and at the same time, consider improving the knockout efficiency. The sgRNA cuts the donor. sgRNA is designed at the 3' end of exon7 to screen cell clones with frameshift mutations, and the mouse CD20 knockout strategy is as follows Figure 5 shown.
[0097] According to CRISPR Cas9 technology, two sgRNAs were designed at the 5' end of mouse CD20 exon1 and the 3' end of exon7 respectively. Specific steps are as follows:
[0098] (1) Synthesize the upstream and downstream primers of sgRNA respectively, and the primer purification method is PAGE, and the primer sequences are shown in Table 4;
[0099] Table 4 Primer list for sgRNA construction
[0100]
[0101] (2) The upstream and downstream primers of sgRNA were diluted to 100 umol / ul, mixed at a ratio ...
Embodiment 3
[0110] Example 3. Construction and identification of A20-hCD20(Tg)-mCD20(KO)-Luciferase cell line
[0111] 1. Construction of A20-hCD20(Tg)-mCD20(KO)-Luciferase cell line
[0112] (1) Determination of the optimal working concentration for G418 resistance screening
[0113] A20 cells were cultured in 1640 medium containing 10% fetal bovine serum at 37°C in 5% CO 2 ; A20 cells in the logarithmic growth phase were taken, and the cell concentration was adjusted to 1×10 5 / mL, 1×10 5 Cells were inoculated into each well of a 24-well plate and cultured overnight, and Neo-resistant G418 was diluted to obtain 9 gradients of 0-800 μg / mL, which were added to the 24-well plate for resistance pressure screening, and one replicate well was set for each concentration. Follow up to observe the growth of A20 cells. The lowest concentration of G418 that can cause all cells to die within 5-7 days is the optimal working concentration of 400 μg / mL for screening and transfecting A20 cells.
[...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 



