Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

KCNMA1 gene SNP marker usable for assisting in accurate medication of clopidogrel

A clopidogrel and precision medicine technology, applied in the field of medicine, to achieve the effect of improving sensitivity and specificity, and being easy to detect

Inactive Publication Date: 2020-10-02
PEKING UNIV FIRST HOSPITAL +1
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] Aiming at the problems that cannot be solved by the existing method of predicting individual differences of clopidogrel based on CYP2C19 polymorphism, the purpose of the present invention is to provide a KCNMA1 gene SNP site that can be used to predict the ACS associated with the treatment of ACS by the antiplatelet drug clopidogrel, It can be used for the clinical medication guidance of the antiplatelet drug clopidogrel in the treatment of ACS patients, preventing drug resistance, enhancing the therapeutic effect and reducing adverse reactions

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • KCNMA1 gene SNP marker usable for assisting in accurate medication of clopidogrel
  • KCNMA1 gene SNP marker usable for assisting in accurate medication of clopidogrel
  • KCNMA1 gene SNP marker usable for assisting in accurate medication of clopidogrel

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0018] Embodiment 1 Relationship between SNP mutation and PRU

[0019] 1. Determination of Clopidogrel Response Units (PRU)

[0020] In order to explore the relationship between genetic polymorphisms and clopidogrel pharmacodynamics and adverse drug reactions, patients with coronary heart disease who were taking antiplatelet drugs were included, and 71 patients underwent platelet function testing by Verify Now detector. The effectiveness of clopidogrel reaches the steady-state plasma concentration (clopidogrel 75mg daily for more than 7 days; or the first 300mg loading dose, 75mg daily for 5 days; or the first 600mg loading dose, 75mg daily for 3 days) Platelet function tests were then performed. Platelet activity was assessed using the Verify Now P2Y12 (VN-P2Y12) assay (Accumetrics, San Diego, California, USA), which is a whole blood, point-of-care, light-transmission-based optical detection method that primarily measures adenosine diphosphate ( adenosine diphosphate (ADP)...

Embodiment 2

[0030] Example 2 The PCR amplification method adopted by the SNP rs16934371 detection kit

[0031] 1. Primer design for SNP rs16934371

[0032] Using https: / / www.ncbi.nlm.nih.gov / tools / primer-blast as a primer design tool, the base within 100 before and after the 77222795th site of KCNMA1 (potassium calcium-activated channel subfamily M alpha 1) Based on the sequence of the search primers, a series of primers were obtained. According to the conventional principles and experimental screening, the primers were determined as:

[0033] Forward primer: GGCAATCAGCTTCAATCCTCTG

[0034] Reverse primer: AGGCAGAGGATTGAAGCTGAT

[0035] 2. Genomic DNA extraction of samples to be tested

[0036] Select 2 patients from each of the above-mentioned populations with different genotypes to draw blood samples, and use DNA purification kit ( Promega, USA), genomic DNA was extracted from peripheral whole blood samples of each subject.

[0037] 3. Amplify the DNA

[0038] Use 10ng / 10μl rea...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses an SNP marker related to accurate medication of an antiplatelet drug clopidogrel for treating ACS, an application of the SNP marker and a specific amplification primer for detecting the marker. The SNP marker is rs16934371 on a KCNMA1 gene, can well distinguish CAS crowds for whom the clopidogrel is low in efficacy and effective, and helps accurate medication of the clopidogrel, and the application of the SNP marker and the amplification primer thereof in preparation of related detection kits are clarified.

Description

technical field [0001] The invention belongs to the technical field of medicine. More specifically, it relates to a KCNMA1 gene SNP marker for predicting the dose, curative effect and side effects of the antiplatelet drug clopidogrel in treating ACS and its application. Background technique [0002] Acute coronary syndrome (ACS) is a group of clinical syndromes based on the rupture and invasion of coronary atherosclerotic plaques, followed by complete or incomplete occlusive thrombosis, including acute ST-segment elevation myocardial infarction, Acute non-ST-segment elevation myocardial infarction and unstable angina (UA). ACS is a common serious cardiovascular disease and a severe type of coronary heart disease, which can lead to arrhythmia, heart failure, and even sudden death, seriously affecting the quality of life and life expectancy of patients. Percutaneous coronary intervention (PCI) for unblocking narrowed coronary arteries is a widely used technique for treating ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/6883C12N15/11
CPCC12Q1/6883C12Q2600/106C12Q2600/156
Inventor 崔一民向倩刘志艳母光妍徐为人李川
Owner PEKING UNIV FIRST HOSPITAL
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com