KCNMA1 gene SNP marker usable for assisting in accurate medication of clopidogrel
A clopidogrel and precision medicine technology, applied in the field of medicine, to achieve the effect of improving sensitivity and specificity, and being easy to detect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0018] Embodiment 1 Relationship between SNP mutation and PRU
[0019] 1. Determination of Clopidogrel Response Units (PRU)
[0020] In order to explore the relationship between genetic polymorphisms and clopidogrel pharmacodynamics and adverse drug reactions, patients with coronary heart disease who were taking antiplatelet drugs were included, and 71 patients underwent platelet function testing by Verify Now detector. The effectiveness of clopidogrel reaches the steady-state plasma concentration (clopidogrel 75mg daily for more than 7 days; or the first 300mg loading dose, 75mg daily for 5 days; or the first 600mg loading dose, 75mg daily for 3 days) Platelet function tests were then performed. Platelet activity was assessed using the Verify Now P2Y12 (VN-P2Y12) assay (Accumetrics, San Diego, California, USA), which is a whole blood, point-of-care, light-transmission-based optical detection method that primarily measures adenosine diphosphate ( adenosine diphosphate (ADP)...
Embodiment 2
[0030] Example 2 The PCR amplification method adopted by the SNP rs16934371 detection kit
[0031] 1. Primer design for SNP rs16934371
[0032] Using https: / / www.ncbi.nlm.nih.gov / tools / primer-blast as a primer design tool, the base within 100 before and after the 77222795th site of KCNMA1 (potassium calcium-activated channel subfamily M alpha 1) Based on the sequence of the search primers, a series of primers were obtained. According to the conventional principles and experimental screening, the primers were determined as:
[0033] Forward primer: GGCAATCAGCTTCAATCCTCTG
[0034] Reverse primer: AGGCAGAGGATTGAAGCTGAT
[0035] 2. Genomic DNA extraction of samples to be tested
[0036] Select 2 patients from each of the above-mentioned populations with different genotypes to draw blood samples, and use DNA purification kit ( Promega, USA), genomic DNA was extracted from peripheral whole blood samples of each subject.
[0037] 3. Amplify the DNA
[0038] Use 10ng / 10μl rea...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


