Unlock instant, AI-driven research and patent intelligence for your innovation.

Kit for detecting onset risk of low-grade non-muscular invasive bladder cancer

An invasive, low-grade technology, applied in the field of kits for detecting the risk of low-grade non-muscle invasive bladder cancer, can solve the problems of high price of sequencing technology, and achieve a short detection cycle, simple operation, and reliable prediction. Effect

Inactive Publication Date: 2020-11-24
THE SECOND HOSPITAL OF TIANJIN MEDICAL UNIV
View PDF3 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Existing sequencing technologies are mostly expensive

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Kit for detecting onset risk of low-grade non-muscular invasive bladder cancer
  • Kit for detecting onset risk of low-grade non-muscular invasive bladder cancer
  • Kit for detecting onset risk of low-grade non-muscular invasive bladder cancer

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0028] A kit for detecting the risk of developing low-grade non-muscle-invasive bladder cancer, comprising:

[0029] (1) A fluorescently labeled probe that specifically recognizes the mutation at the rs907611 site of the LSP1 gene promoter, the nucleotide sequences of its universal probe and differential probe are as follows:

[0030] Universal probe for rs907611: -P-CCATCTTGGCCCTCGCACCCCGTCT-FAM- (SEQ ID NO 1)

[0031] Differential probe A sequence of rs907611: CCGAGCCATGAAGAGCTGCCTGCGA (SEQ ID NO 2)

[0032] Difference probe G sequence of rs907611: TTTCCGAGCCATGAAGAGCTGCCTGCGG (SEQ ID NO 3)

[0033] (2) Specific primers for detecting the rs907611 site mutation of the LSP1 gene promoter, the nucleotide sequence is as follows:

[0034] Upstream primer: 5'-CCCAAAGAAGCTAAAACGCTC-3' (SEQ ID NO 4);

[0035] Downstream primer: 5'-AGCGTTAAGCAAGTTACAGGG-3' (SEQ ID NO 5);

[0036] (3) Master Mix, which includes: 1×PCR buffer, 0.2μM dNTPs, 40U / ul one Taq DNA polymerase and 10ng DNA...

Embodiment 2

[0039] Utilize the kit of embodiment 1 to detect LSP1 gene promoter mutation, comprise the following steps:

[0040] (1) Extract the blood of the sample to be tested (the venous blood of the Chinese Han population), extract the genomic DNA of the cells by the phenol method, and the genomic DNA of the extracted sample is quantified at about 1ng / ul-10ng / ul.

[0041] (2) PCR amplification

[0042] PCR reaction system

[0043]

[0044] Amplification conditions:

[0045]

[0046] (3) Connection reaction:

[0047]

[0048]

[0049] Connection conditions: 94°C 30s

[0050] 56℃ 3min 30cycles

[0051](4) Take 1ul extension product, add 8ul loading sample, denature at 95°C for 3min, immediately put it in ice-water bath, put it on the sequencer, and obtain the typing result (such as figure 1 shown).

[0052] The templates and primers required for the experiment are as follows:

[0053] Upstream primer: 5'-CCCAAAGAAGCTAAAACGCTC-3' (SEQ ID NO 4);

[0054] Downstream pri...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a kit for detecting the onset risk of low-grade non-muscular invasive bladder cancer. The kit comprises: (1) a fluorescence-labeled probe for specifically identifying mutationof the rs907611 site of a promoter of an LSP1 gene; (2) specific primers for detecting mutation of the rs907611 site of the promoter of the LSP1 gene; (3) a Master Mix, which comprises a 1*PCR buffersolution, dNTPs with a concentration of 0.2 [mu]M, one Taq DNA polymerase with a concentration of 40 U / [mu]l and 10 ng of a DNA template; and (4) an operation instruction. Genome DNA is extracted fromblood samples of a Chinese Han population through a phenol extraction method, genotyping is conducted through a PCR-LDR method, and whether detected people have susceptibility to bladder cancer or not is detected. The kit disclosed by the invention has the advantages of simple principles, simplicity in operation, short detection period and reliable predictability of results, and is applicable toclinical screening of Chinese Han populations with high risk of Han bladder cancer.

Description

technical field [0001] The invention belongs to the technical field of medical detection kits, and relates to a kit for detecting the incidence risk of low-grade non-muscle invasive bladder cancer. Background technique [0002] Bladder cancer (BCa) is one of the most common malignant tumors of the urinary system, and its incidence has shown a trend of increasing significantly in recent years. Bladder cancer includes a variety of pathological types, such as urothelial carcinoma, squamous cell carcinoma, adenocarcinoma, sarcoma, etc., and more than 95% of bladder cancers are urothelial carcinoma. The pathogenesis of bladder cancer is related to environmental and genetic factors. Smoking, schistosome infection, occupational exposure to chemical carcinogens, dietary habits, and environmental pollution are all risk factors for bladder cancer. However, among the large population exposed to these risk factors, only a small proportion of those at high risk developed bladder cancer...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/6886C12Q1/686C12N15/11
CPCC12Q1/6886C12Q1/686C12Q2600/156C12Q2561/125
Inventor 蒋宁王淼淼廖义浩王佑之吴长利
Owner THE SECOND HOSPITAL OF TIANJIN MEDICAL UNIV
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More