Candida utilis expression vector for producing laccase, construction method of candida utilis expression vector, recombinant engineering bacteria and application of recombinant engineering bacteria
A technology for the expression of Candida utilis and yeast, which is applied in the biological field and can solve problems such as unsatisfactory strains and limited applications
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0052] The present embodiment provides a laccase-producing Candida utilis genetically engineered bacterium, comprising:
[0053] 1. Construct the expression vector containing laccase gene (LAC);
[0054] 2. Deletion of DNA fragments from prokaryotic microorganisms in the integrated expression vector of Candida utilis;
[0055] 3. Deleting the prokaryotic DNA sequence and transforming it into a yeast strain.
[0056] The specific process is as follows:
[0057] 1 Construction of expression vector containing laccase gene (LAC)
[0058] 1.1 Cloning of laccase gene
[0059] Total RNA was extracted from Trametes versicolor (refer to TIANGEN RNA extraction kit method); using the extracted total RNA of Yunzhi bacteria as a template, the BCabest RNA PCR amplification kit was used for RT-PCR amplification. increase. The primer sequences are as follows:
[0060] LAC-R1: CAACATGTCGAGGTTTCACTCTC;
[0061] LAC-R2: CCATTTACTGGTCGCTGGGGT.
[0062] Use E.L.N.ATm Gel Extraction Kit (D2...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap