Unlock instant, AI-driven research and patent intelligence for your innovation.

Candida utilis expression vector for producing laccase, construction method of candida utilis expression vector, recombinant engineering bacteria and application of recombinant engineering bacteria

A technology for the expression of Candida utilis and yeast, which is applied in the biological field and can solve problems such as unsatisfactory strains and limited applications

Pending Publication Date: 2020-12-08
INNER MONGOLIA AUTONOMOUS REGION ACAD OF AGRI & ANIMAL HUSBANDRY SCI
View PDF1 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0007] To this end, the present invention provides a laccase-producing Candida utilis genetically engineered bacterium and its application, which solves the problem in the prior art that microbial strains expressing lignin-degrading enzymes heterologously do not meet food-grade requirements and are limited in application. technical problem

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Candida utilis expression vector for producing laccase, construction method of candida utilis expression vector, recombinant engineering bacteria and application of recombinant engineering bacteria
  • Candida utilis expression vector for producing laccase, construction method of candida utilis expression vector, recombinant engineering bacteria and application of recombinant engineering bacteria
  • Candida utilis expression vector for producing laccase, construction method of candida utilis expression vector, recombinant engineering bacteria and application of recombinant engineering bacteria

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0052] The present embodiment provides a laccase-producing Candida utilis genetically engineered bacterium, comprising:

[0053] 1. Construct the expression vector containing laccase gene (LAC);

[0054] 2. Deletion of DNA fragments from prokaryotic microorganisms in the integrated expression vector of Candida utilis;

[0055] 3. Deleting the prokaryotic DNA sequence and transforming it into a yeast strain.

[0056] The specific process is as follows:

[0057] 1 Construction of expression vector containing laccase gene (LAC)

[0058] 1.1 Cloning of laccase gene

[0059] Total RNA was extracted from Trametes versicolor (refer to TIANGEN RNA extraction kit method); using the extracted total RNA of Yunzhi bacteria as a template, the BCabest RNA PCR amplification kit was used for RT-PCR amplification. increase. The primer sequences are as follows:

[0060] LAC-R1: CAACATGTCGAGGTTTCACTCTC;

[0061] LAC-R2: CCATTTACTGGTCGCTGGGGT.

[0062] Use E.L.N.ATm Gel Extraction Kit (D2...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a candida utilis expression vector for producing laccase, a construction method of the candida utilis expression vector, recombinant engineering bacteria and an application of the recombinant engineering bacteria. The candida utilis expression vector for producing the laccase comprises a 18S rDNA gene segment, a yeast glyceraldehyde triphosphate dehydrogenase gene promoter sequence (GAP-p), a laccase gene, a yeast glyceraldehyde triphosphate dehydrogenase gene terminator sequence (GAP-t) and a cycloheximide (CYH) resistance gene. According to the invention, all genetic elements of the whole expression system are from probiotic candida utilis and non-toxic and harmless fungi, antibiotic resistance genes are not carried, drifting, diffusion and integration of the resistance genes do not exist, other toxic protein genes are not carried, biosafety hazards to the environment or people and animals are avoided, the food grade is achieved, and the recombinant engineeringbacteria can be directly added into foods, medicines and feeds for application.

Description

technical field [0001] The invention belongs to the field of biotechnology, and in particular relates to a laccase-producing Candida utilis expression vector, a construction method thereof, recombinant engineering bacteria and applications thereof. Background technique [0002] Inner Mongolia is rich in straw resources, with an annual output of 3.5 billion kilograms of various crop straws in the region, which is equivalent to twice the amount of grass mowed on natural grasslands in the region. At present, the vast majority of straw is still fed to livestock by simple crushing, pressing into granules and silage production. The apparent digestibility of dry matter (DM) in simply processed corn stalks by dairy cows is 63.38%, the apparent digestibility of neutral detergent fiber (NDF) is 62.06%, and the apparent digestibility of acid detergent fiber (ADF) is 50.36%. The apparent digestibility of beef cattle to neutral detergent fiber in simply crushed wheat straw was 56.87%, ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N1/19C12N15/53C12N15/81C12N15/66C12R1/72
CPCC12N9/0061C12N15/815C12Y110/03002
Inventor 呼和高娃其布日萨初拉苏少锋吴青海王蕴华刘红葵
Owner INNER MONGOLIA AUTONOMOUS REGION ACAD OF AGRI & ANIMAL HUSBANDRY SCI