Method for inhibiting genes in gluconobacter oxydans

A technology of gluconic acid bacteria and oxidizing glucose, which is applied in the fields of genetic engineering and bioengineering, can solve the problems of resistance integration restriction, many false positives of pentafluorouracil, and increase the workload, so as to inhibit expression, improve gene editing efficiency, and effectively express Effect

Active Publication Date: 2020-12-18
JIANGNAN UNIV
View PDF1 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Resistance integration is severely constrained by the natural resistance of Gluconobacter oxydans to multiple antibiotics
In addition, due to the use of pentafluorouracil for reverse selection, there are many false positives, which greatly increases the workload.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for inhibiting genes in gluconobacter oxydans
  • Method for inhibiting genes in gluconobacter oxydans
  • Method for inhibiting genes in gluconobacter oxydans

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0035] Embodiment 1: crRNA system inhibits the expression of mCherry in Gluconobacter oxidans

[0036] Designed for vector p2-5-p 116 - mCherry linearized primer pair F1 and R1,

[0037] F1:

[0038] atcctctggatgcaacgatcctgaagc ctcgtgtgttccccgcacacgcggggatgaaccgttttttttcgtcagcgggtgttggc (the underlined part is the homology arm sequence, the same below),

[0039] R1: tcaatattgagcccacggaaaactttcccacgccctgacgggcttg .

[0040] As laboratory preserved p2-5-p 116-mCherry plasmid (SEQ ID NO.2) was used as a template, and the primers were used for PCR linear amplification, and 2×Phanta Max Master Mix (Vazyme Company) was selected for pre-denaturation at 95°C for 3 minutes; amplification stage 30 cycles, according to 95°C, 15s, 56°C, 15s, 72°C, 4min; final extension at 72°C, 5min.

[0041] Designed to amplify p Atse - Primer pair F2 and R2 for mCherrycrRNA sequence

[0042] F2:

[0043] tgggaaagttttccgtgggc,

[0044] R2:

[0045] gcttcaggatcgttgcatccagaggat cggttcatcccc...

Embodiment 2

[0049] Embodiment 2: Use crRNA system to suppress the expression of edd in Gluconobacter oxydans

[0050] The gene edd (nucleotide sequence shown in SEQ ID NO.3) on the genome of Gluconobacter oxydans WSH-003 is weakened.

[0051] Primer F3 designed for linearization of vector p2-5,

[0052] F3:

[0053] gggcgtctcgcgtccgcgtctggcctgcggaaag tgttccccgcacacgcggggatgaaccgttttttttcctcttcgctattacgccag.

[0054] Utilize F3 and R1, use the p2-5 plasmid (SEQ ID NO.4) preserved in the laboratory as a template, use the primers to perform PCR linear amplification, select 2×Phanta Max Master Mix (Vazyme Company) to carry out, the condition Pre-denaturation at 95°C, 3min; 30 cycles of amplification, 95°C, 15s, 56°C, 15s, 72°C, 3min; final extension at 72°C, 5min.

[0055] Designed to amplify p Atse -crRNA edd sequence of primer R3,

[0056] R3:

[0057] tccgcaggccagacgcggacgcgagacgccc ggttcatccccgcgtgtgcggggaacacaaaccaatgaaaaataaagattattccgttc.

[0058] Using primers F2 and R3, a...

Embodiment 3

[0063] Embodiment 3: utilize crRNA system to suppress the expression of gnd in Gluconobacter oxydans

[0064] The gene gnd (nucleotide sequence shown in SEQ ID NO.5) on the genome of Gluconobacter oxydans WSH-003 is weakened.

[0065] Primer F4 designed for linearization of vector p2-5,

[0066] F4: gtgggcgcgccacgggggcagacacatt cgaggtgttccccgcacacgcggggatgaaccgttttttttcctcttcgctattacgcc.

[0067] Use F4 and R1, use the p2-5 plasmid stored in the laboratory as a template, and use the primers to perform PCR linear amplification on it. Select 2×Phanta Max Master Mix (Vazyme Company) for pre-denaturation at 95°C for 3 minutes. ; Amplification stage 30 cycles, according to 95 ℃, 15s, 56 ℃, 15s, 72 ℃, 3min; final extension 72 ℃, 5min.

[0068] Designed to amplify p Atse -crRNA gnd sequence of primer R4,

[0069] R4:

[0070] aatgtgtctgcccccgtggcgcgcccac cggttcatccccgcgtgtgcggggaacacaaaccaatgaaaaataaagattattccgttcg.

[0071] Using F2 and R4, and using the Gluconobacter oxi...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a method for inhibiting genes in gluconobacter oxydans, and belongs to the technical field of gene engineering and bioengineering. According to the method, a corresponding target gene crRNA is expressed in the gluconobacter oxydans. By verifying the inhibition effect on mCherry fluorescence expression on plasmids, the recombinant gluconobacter oxydans has a gene inhibitioneffect, and by inhibiting other genes in the gluconobacter oxydans genome, a similar inhibition effect is also achieved, and the inhibition function of the system on the genes on the genome is furtherproved. A new method for inhibiting the target genes in the gluconobacter oxydans is provided, the expression of the target genes can be rapidly and effectively inhibited, and the gene editing efficiency of the gluconobacter oxydans is improved.

Description

technical field [0001] The invention relates to a method for gene suppression in Gluconobacter oxydans, belonging to the technical fields of genetic engineering and bioengineering. Background technique [0002] Gluconobacter oxidans is a part of the acetic acid bacteria group. Because of its ability to incompletely oxidize a wide range of carbohydrates and alcohols, Gluconobacter oxidans strains have been successfully used in food, medicine and cosmetics and other industrial fields to produce vitamin C, Products such as Miglitol, Dihydroxyacetone and Gluconate. In particular, Gluconobacter oxydans has important applications in the production of food additives and sweeteners because it can synthesize flavoring ingredients using aromatic alcohols, fatty alcohols and 5-ketofructose as substrates. Since Gluconobacter oxydans does not have a complete glycolysis and citric acid cycle, its main central carbon metabolism pathways are the pentose phosphate pathway and the Entner-Dou...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/113C12N15/63C12N1/21C12R1/01
CPCC12N15/113C12N15/63C07K14/195C12N2310/20
Inventor周景文秦志杰刘立陈坚曾伟主堵国成
OwnerJIANGNAN UNIV