Eureka AIR delivers breakthrough ideas for toughest innovation challenges, trusted by R&D personnel around the world.

Method for improving expression quantity of gamma-glutamine transpeptidase through RBS optimization

A technology of glutamine and RBS sequences, applied in the field of genetic engineering, can solve the problems of low expression and increased upstream production costs, etc.

Active Publication Date: 2020-12-22
JIANGNAN UNIV
View PDF6 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

At the same time, it was found that the signal peptide fragment of γ-glutamine transpeptidase protein can be recognized in Corynebacterium bacilli, thereby guiding the secretion of the target protein to the extracellular space, but the extracellular γ-glutamine transpeptidase activity was only 10.31U / mL, and applied for a related patent (application number 201610454875.8), and a method for increasing the expression of γ-glutamine transpeptidase (application number: 201610576989.X) mentioned that coryneform bacteria were used as hosts , and adding a poly(A / T) tail after the γ-glutamine transpeptidase gene, the enzyme activity is only 20.62U / mL; however, compared with the requirements of industrial production, the expression level of the enzyme is low, Will increase upstream production costs

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for improving expression quantity of gamma-glutamine transpeptidase through RBS optimization
  • Method for improving expression quantity of gamma-glutamine transpeptidase through RBS optimization
  • Method for improving expression quantity of gamma-glutamine transpeptidase through RBS optimization

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0030] Embodiment 1: Construction of the recombinant vector of γ-glutamine transpeptidase

[0031] Obtaining the gamma-glutamine transpeptidase ggt gene: chemically synthesizing the gamma-glutamine transpeptidase ggt gene whose nucleotide sequence is shown in SEQ ID NO.5.

[0032] The pMA5 plasmid and the ggt gene obtained above were digested with BamHI and MluI respectively to obtain the digested product. After purification, the digested product was ligated with homologous recombination ligase at 37°C for 1 hour to obtain the ligated product; The ligation product was transformed into Escherichia coli JM109 competent cells by chemical method to obtain the transformation product; the transformation product was coated with LB solid medium containing ampicillin (100mg / L), the correct clone was picked, and the plasmid was extracted for sequencing. The constructed recombinant plasmid was cut and verified, and the recombinant original plasmid was obtained, which was named pMA5-WT-gg...

Embodiment 2

[0033] Embodiment 2: Obtaining of genes containing different RBS sequences

[0034] Using the pMA5-WT-ggt plasmid as a template and the primer sequences in Table 1, gene fragments containing different RBS sequences (such as Table 2) were constructed. Get the modified gene respectively: RBS 361 -ggt, RBS 362 -ggt, RBS 372 -ggt, RBS 391 -ggt, RBS 403 -ggt, RBS 413 -ggt, RBS 425 -ggt, RBS 437 -ggt, RBS 445 -ggt, RBS 453 -ggt.

[0035] Table 1 Primer Sequence

[0036]

[0037]

[0038] Table 2 Sequences of different RBSs

[0039] name sequence WT GCCACCTAAAAAGGAGCGATTTA (SEQ ID NO. 2) RBS 361

Embodiment 3

[0040] Example 3: Construction of recombinant vectors containing gamma-glutamine transpeptidases with different RBS sequences

[0041] (1) Using the pMA5 plasmid as a template, use the following primer sequences pMA5-F and pMA5-R for inverse PCR respectively, and then digest with DpnI at 37°C for 1 hour to obtain the digested product.

[0042] pMA5-F: ACGCGTTTCTAGAGGTCGAAATTCACCTCGAAAGCA (SEQ ID NO. 34)

[0043] pMA5-R: ACAAATGTGAGGCATTTTCGCTCTTTCCGGCAACC (SEQ ID NO. 35)

[0044] (2) The ggt gene obtained by step (1) and the ggt gene containing different RBS sequences obtained in Example 2: RBS 361 -ggt, RBS 362 -ggt, RBS 372 -ggt, RBS 391 -ggt, RBS 403 -ggt, RBS 413 -ggt, RBS 425 -ggt, RBS 437-ggt, RBS 445 -ggt, RBS 453 -ggt, after purification, connect with homologous recombination ligase at 37°C for 1 hour to obtain the ligation product.

[0045] (3) The ligation product obtained in step (2) is transformed into Escherichia coli JM109 competent cells by a chemical...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a method for improving the expression quantity of gamma-glutamine transpeptidase through RBS optimization, and belongs to the field of gene engineering. The initial translationrate has great influence on expression of foreign protein, the translation rate can be further increased by modifying the RBS sequence and optimizing RBS, and therefore, the expression quantity of target protein is increased to a great extent. According to the method, the RBS sequence of an expression vector pMA5 is modified, the translation efficiency of enzyme is improved, and therefore, the enzyme activity is improved; and in the recombinant bacillus subtilis constructed by adopting the vectors pMA5-RBS361 and pMA5-RBS362, the enzyme activity of the target gene gamma-glutamine transpeptidase is improved, and compared with the original pMA5-ggt / B.subtilius 168, the expression quantity of the vectors pMA5-RBS361 and pMA5-RBS362 is improved by 1.51 times and 1.62 times respectively.

Description

technical field [0001] The invention relates to a method for optimizing RBS and increasing the expression level of gamma-glutamine transpeptidase, which belongs to the field of genetic engineering. Background technique [0002] γ-glutamyltranspeptidase (γ-glutamyltranspeptidase, γ-GT, EC2.3.2.2) is responsible for catalyzing the transfer of γ-glutamyl molecules of γ-glutamyl compounds to other receptor molecules such as amino acids and short peptides On (transpeptide reaction) or on water molecules (hydrolysis reaction), widely exists in mammals and bacteria. γ-Glutamine transpeptidase can be used for clinical diagnosis, catalytic synthesis of amino acid derivatives, catalytic synthesis of drugs or prodrugs, catalytic synthesis of theanine, glutathione, etc., and can also be used to improve certain bitter amino acids flavor. This is of great significance for the development of medicine, chemical industry and food. At the same time, γ-glutamine transpeptidase is also used ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/75C12N15/67C12N1/21C12N9/10C12P13/04C12R1/125
CPCC12N15/75C12N15/67C12N9/104C12P13/04C12Y203/02002C12N2840/105
Inventor 饶志明杨套伟刘栓英张显徐美娟
Owner JIANGNAN UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com