Application of protein encoded by salmonella phage gene as gram-negative bacterium lyase

A technology for Gram-negative bacteria and Salmonella, applied in the direction of lyase, application, genetic engineering, etc., can solve the problems of few application examples and the inability to produce Gram-negative bacteria decidual cells, etc., and achieve the effect of high lysis effect

Active Publication Date: 2021-01-05
HUAZHONG AGRI UNIV
View PDF12 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, for Gram-negative bacterial lyase, due to the restriction of its outer membrane, there are few related application examples
Lyases can be used in the research of deciduous vaccines or active substance delivery vehicles by lysing the decidual cells formed by Gram-negative bacteria. However, not all lytic enzymes have good internal cleavage effects, so some lytic enzymes do not have Ability to make decidual cells of Gram-negative bacteria

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of protein encoded by salmonella phage gene as gram-negative bacterium lyase
  • Application of protein encoded by salmonella phage gene as gram-negative bacterium lyase
  • Application of protein encoded by salmonella phage gene as gram-negative bacterium lyase

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0020] Construction of Engineering Strain and Determination of Self-lysis Curve

[0021] 1. Lyase gene cloning and pBAD24-ORF 40 vector construction

[0022] Using the base sequence of ORF 40 (shown in SEQ ID NO.1, the corresponding amino acid sequence is shown in SEQ ID NO.2) as a template, the upstream and downstream primers ORF 40-F and ORF 40-R for inserting the gene were designed, and the plasmid The sequence of pBAD 24 was used as a template to design the upstream and downstream primers pBAD24-F and pBAD24-R for plasmid linearization, and the primers ORF 40-F and ORF 40-R for inserting the gene had the same The source sequence was synthesized by Shanghai Shenggong Company.

[0023] orf 40-f: ttgggctagcaggaggaattcaccatgaagtcgcgtcgaa ga aga

[0024] orf 40-r:caaaacagccaagcttgcacgttattattgcaccggttttgaca

[0025] pbad24-f:taacgtgcaagcttggctgttttg

[0026] pbad24-r:ggtgaattcctcctgctagcccaa

[0027] The procedure for PCR amplification of the target gene ORF40 was as follo...

Embodiment 2

[0036] Escherichia coli decidual cells

[0037] 1. Identification of chloramphenicol-resistant pBAD 24-ORF 40 recombinant plasmid

[0038] Make Escherichia coli X7213 competent cells, and transform the constructed recombinant plasmid pBAD24-ORF 40 into X7213 competent cells.

[0039] Use ORF 40-F and ORF 40-R as primers to verify the transformants by PCR, and take the PCR products for gel electrophoresis, and the bands shown are consistent in size with the target bands, as shown in Figure 4 Shown in A.

[0040] 2. Conjugative transfer to Salmonella typhimurium and pathogenic E. coli

[0041] Salmonella typhimurium ATCC 13311 and Escherichia coli ATCC 700728 were used as recipient bacteria, and Escherichia coli X7213 carrying the recombinant plasmid pBAD 24-ORF 40 resistant to chloramphenicol was used as donor bacteria to construct a decidual strain by conjugative transfer. Pick the transformants on the transformation plate to inoculate and culture, use the bacterial soluti...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the technical field of biology, and particularly relates to application of a protein encoded by a salmonella phage gene as a lyase. The amino acid sequence of the protein is shown as SEQ ID NO.2, and the nucleotide sequence of the gene encoding the protein is shown as SEQ ID NO. 1. The invention finds for the first time that the protein shown as SEQ ID NO.2 has the effectof the lyase, by the protein, self-internal-cracking of gram-negative bacteria such as escherichia coli can be achieved, and the lyase has a high cracking effect and has a cracking effect on various different escherichia coli and salmonella.

Description

technical field [0001] The invention belongs to the field of biotechnology, and in particular relates to the application of a protein encoded by a Salmonella phage gene as a lyase. Background technique [0002] The lyase encoded by the phage is produced in the later stage of the bacteriophage infecting the bacteria, and the lyase achieves the effect of cracking the bacteria by acting on the peptidoglycan layer of the bacterial cell wall. At present, there are many researches on the lyase of positive bacteria in the world. Since it does not have the outer membrane of the cell wall, the lyase added from an external source can directly act on the bacteria, and the effect of bacteriostasis and sterilization can be achieved by lysing the bacterial cell wall. However, for Gram-negative bacterial lyases, which have the outer membrane of the cell wall, they are highly resistant to exogenously added lyases. In current studies, membrane-penetrating agents are often used in combination...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N9/88C12N15/60C12N1/06C12R1/19C12R1/42
CPCC12N9/88C12N1/06
Inventor李锦铨徐偲月晏婷
OwnerHUAZHONG AGRI UNIV