SNP molecular marker closely linked with solanum melongena fruit length major QTL locus and application

Abstract

The invention relates to the technical field of molecular genetic breeding, and particularly discloses an SNP molecular marker closely linked with an solanum melongena fruit length major QTL locus, adetection method and application. The SNP molecular marker is located on the 78393511st basic group of an solanum melongena chromosome 3, and the 78393511st basic group is T or A; the SNP locus is converted into a KASP marker; a KASP primer is a forward primer, F-1: GAAGGTGACCAAGTTCATGCTCGACAATGTTCACGGAACAAGT, as shown in SEQ ID NO: 3, a forward primer, F-2: GAAGGTCGGAGTCAACGGATTCGACAATGTTCACGGAACAAGA, as shown in SEQ ID NO: 4, and a reverse primer, R: AGATATACTAGGATTTGGTTTC, as shown in SEQ ID NO: 5. The molecular marker has the characteristics of reducing the breeding workload, shortening the breeding time and improving the breeding efficiency.

Description

Technical field[0001]The present invention relates to the technical field of molecular genetic breeding, in particular to a SNP molecular marker closely linked to a major QTL site of eggplant fruit length, a detection method and application.Background technique[0002]Eggplant (Solanommelongena L., 2n = 24) is an important vegetable crop of the Solanaceae (Solanaceae) genus (Solanum), which has important agricultural economic value and health care effects; my country is the first producer of eggplants, and the annual output of eggplants accounts for About 60% of the world's output; my country's eggplant varieties have obvious regional differences due to different ecological environments and consumption habits, especially in fruit length, which is controlled by complex quantitative genetic trait loci (QTL). Using traditional breeding methods to breed eggplant fruit length traits is more time-consuming and laborious. Generally, the fruit length of commercial eggplants can only be known ...

AI Technical Summary

Problems solved by technology

[0004] In order to solve the above-mentioned technical problems existing in the selective breeding process of eggplant fruit length, the present invention provides a SNP molecular marker closely linked to the main effect QTL site of eggplant fruit length, a detection method and an application, which has the function of reducing breeding The characteristics of workload, shortening breeding time and improving breeding efficiency

Images