Treatment of diseases by liver expression of an enzyme which has a deoxyribonuclease (DNASE) activity

A technology of DNase and nucleic acid, which is applied in the field of treating diseases by expressing enzymes with deoxyribonuclease (DNase) activity through the liver, which can solve limited problems

Pending Publication Date: 2021-01-29
CLS治疗有限公司
View PDF42 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0011] Although systemic administration of DNase proteins appears to be useful in the treatment of diseases and conditions associated with increased amounts of circulating cfDNA, systemic therapy with DNase proteins has shown limited efficacy in clinical settings (see, e.g., International Application Publication No. WO2014 / 020564)

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Treatment of diseases by liver expression of an enzyme which has a deoxyribonuclease (DNASE) activity
  • Treatment of diseases by liver expression of an enzyme which has a deoxyribonuclease (DNASE) activity
  • Treatment of diseases by liver expression of an enzyme which has a deoxyribonuclease (DNASE) activity

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0376] Example 1: Limited Ability of DNase to Digest Circulating Cell-Free DNA (cfDNA) in Cancer Patients

[0377] Nine patients with advanced metastatic disease recruited at the Department of Thoracic Surgery of Kostushko Hospital (St. Russian Samson). Treatment was carried out according to the following schedule: 300 mg per day by six 30-minute intravenous infusions during week I; 450 mg per day by six 30-minute intravenous infusions during week II; and 600 mg per day by six 30-minute intravenous infusions.

[0378] Electrophoretic profiling of circulating cfDNA was performed in each patient before the first infusion of DNase I protein, at the end of week II, and immediately after the last infusion of DNase I protein. DNA was isolated from blood plasma using the classical phenol-chloroform method. Blood cfDNA electrophoresis was performed on a 1% agarose gel. DNA was visualized with ethidium bromide. One week after the last infusion of DNase I protein, treatment effic...

Embodiment 2

[0381] Example 2: Accumulation of cell-free DNA in the liver of tumor-bearing animals

[0382] will be approximately 12x 10 6 Two LS174T human colon cancer cells were inoculated subcutaneously into the left flank of twelve 8-week-old female nu / nu mice (IBCH RAS strain). Mice received one intravenous injection of 99mTc-labeled anti-DNA antibody according to the following schedule: three mice received the injection on D5, three mice received the injection on D10, three mice received the injection on D15, and three mice received the injection on D15. Injections were received on D25. Mice were sacrificed two hours after injection, and tissues and blood were collected for gamma counts.

[0383] AC-30-10 DNA-binding antibody (Genetex) was labeled with 99mTc as follows: a 0.024 mg / ml solution of the antibody in 0.3M citrate buffer (pH 4.2) was mixed with 1 mCi of 99mTc-high in 0.25 ml saline. Technetate was mixed and mixed with a 10-mg / ml solution of SnCl2 dihydrate in 0.1N HCl....

Embodiment 3

[0388] Example 3: Source supply of tumor-derived cfDNA from liver to blood

[0389] Six 6-week-old female nude mice (IBCH RAS species) were subcutaneously injected with 2x10 6 MCF-7 cells were injected subcutaneously into the left flank. On day 20 after injection, tumors were surgically removed. On day 25, all mice were anesthetized, and 500 μl blood samples were collected from the portal vein, hepatic artery and hepatic vein of each mouse. Plasma was separated from blood cells by centrifugation at 2000g for 10 minutes; the clear plasma phase on top was transferred to a new tube and centrifuged at 14000g. Transfer the supernatant to a new tube for DNA extraction. cfDNA was extracted from blood plasma samples using the QIAamp DNA Blood Mini Kit according to the manufacturer's instructions. The human β-globin sequence in the cell-free DNA was quantified in each sample by RT-PCR (iCycleriQ5Bio-Rad) using the human β-globin primer CAACTTCATCCACGTTCACC (SEQ ID NO: 10). Table...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to the liver-specific delivery and / or expression of an enzyme which has a deoxyribonuclease (DNase) activity for enhanced clearance of cell free DNA (cfDNA) accumulated in hepatic porto-sinusoidal circulation and the use of such liver-specific delivery and / or expression for treatment of various diseases and conditions, including cancer and neurodegeneration.

Description

[0001] Cross References to Related Applications [0002] This application claims priority to U.S. Provisional Patent Application No. 62 / 617,879, filed January 16, 2018, the disclosure of which is incorporated herein by reference in its entirety. [0003] sequence listing [0004] This application contains a Sequence Listing, which has been filed electronically in ASCII format and is hereby incorporated by reference in its entirety. Said ASCII copy was created on January 10, 2019, named 252732.000003_ST25.txt, and 52,177 bytes in size. technical field [0005] The present invention relates to liver-specific delivery and / or expression of enzymes with deoxyribonuclease (DNase) activity for enhancing clearance of cell-free DNA (cfDNA) accumulated in the portal-sinusoidal circulation, and such Use of liver-specific delivery and / or expression for the treatment of various diseases and disorders, including cancer and neurodegeneration. Background technique [0006] Patients with ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N15/86C07K14/00C07K14/775C07K14/16C07K14/075A61K39/00A61K39/12A61K35/761A61P35/00A61P25/28A61P9/10
CPCA61K38/465A61P1/16A61P35/04A61P25/28C12N9/22C12N15/86C12N2750/14143C12N2750/14145C12N2750/14122C07K14/005A61K48/005A01K2227/105A01K2207/12A01K2267/0331C12N2830/008A61K48/0058A61P35/00A61P9/10G01N2333/435A61B5/4848G01N33/5308G01N2800/7028C12Q1/68A61B2017/00893
InventorD·D·金基恩G·V·泰茨V·V·泰茨
OwnerCLS治疗有限公司