Gene for stably expressing low-temperature germination capacity of rice and molecular marker and application thereof

A low-temperature germination and molecular marker technology, which is applied in the fields of application, genetic engineering, and plant genetic improvement, can solve the problem that rice breeding is not being used efficiently, and achieve the effect of eliminating the phenotypic identification process and speeding up the breeding process

Pending Publication Date: 2021-03-02
RICE RES INST GUANGDONG ACADEMY OF AGRI SCI
View PDF4 Cites 6 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] Although a large number of low-temperature germination QTLs have been mapped in rice, they have not been efficiently utilized in rice breeding
Among them, the location and effect of most QTLs cannot be determined. This is the main reason; on the other hand, low-temperature germination of rice is a complex quantitative trait controlled by multiple genes, and QTLs for low-temperature germination are often affected by environmental and genetic backgrounds. Impact

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Gene for stably expressing low-temperature germination capacity of rice and molecular marker and application thereof
  • Gene for stably expressing low-temperature germination capacity of rice and molecular marker and application thereof
  • Gene for stably expressing low-temperature germination capacity of rice and molecular marker and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0025] A gene mapping method for the stable expression of rice germination ability at low temperature:

[0026] 1. Select material

[0027] From the International Rice Research Institute, 1,568 rice germplasms with different origins and rich genetic diversity were introduced. Based on the genotype information of 700,000 molecular markers in the rice genome, 375 representative germplasms were selected for gene mapping;

[0028] 2. Genome-wide association analysis

[0029] The germplasm of 375 rice germplasms was evaluated at 13°C for low-temperature germination, and then the genotype information of 44,000 SNP molecular markers covering the whole genome that met the calculation requirements was used to conduct genome-wide association analysis through the software GAPIT V2 to identify control genes. The QTL interval of germination ability at low temperature, the threshold value of QTL identification is set at p-4 , 9 QTLs controlling germination ability at low temperature were d...

Embodiment 2

[0036] A tight-linked molecular marker of a gene stably expressed in rice germination ability at low temperature:

[0037] Linkage disequilibrium analysis by further chromosome segments, such as image 3 As shown, the interval range of qLTG10 is determined to be 11.551-11.780Mb;

[0038] Such as Figure 4 As shown, in the 11.551-11.780Mb interval of chromosome 10, there are two large structural variations at 11650kb and 11673kb, and these two variations show regularity in germplasms with strong low-temperature germination ability and weak low-temperature germination ability sex. Therefore, two pairs of molecular markers D22484 and 10ID1 were designed for these two structural differences, and the sequence information of the obtained molecular markers is as follows:

[0039]The forward primer sequence of D22484 is: CGACACTTGCACCATGAATTT;

[0040] The reverse primer sequence is: ATGGCTCTATCTTTGAATGTGC;

[0041] The forward primer sequence of 10ID1 is: TGTTCTGCGTCACCGACTT;

...

Embodiment 3

[0044] Application of tightly linked molecular markers for genes stably expressed at low temperature germination ability of rice:

[0045] According to the TAC and CGT haplotypes of qLTG10, 10 rice germplasms were selected respectively, and they were genotyped with the above two pairs of molecular markers. Figure 5 It can be seen from A that D22484 cannot amplify the product in the CGT haplotype germplasm, and it has a strong low-temperature germination allele, and can amplify a 259bp long product in the TAC type germplasm; in the CGT haplotype The amplified product of 10ID1 in the ploidy type germplasm was 176bp in length, which carried a strong low temperature germination ability allele, while the amplified product in the TAC type germplasm was 166bp in length.

[0046] Depend on Figure 5 It can be seen from B that the low-temperature germination ability of these 10 CGT haplotype germplasms is 74.7%-100%, and the average low-temperature germination ability is 92.1%; The ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the technical field of rice trait gene localization, and particularly relates to a rice low-temperature germination capacity stable expression gene and a molecular marker andapplication thereof. The gene is located in the 11551587-11780489bp interval of the tenth chromosome of a rice genome and is named qTLG10, the low-temperature germination capacity of a TAC haplotype is low, the low-temperature germination capacity of a CGT haplotype is high, the molecular marker comprises D22484 or 10ID1, the obtained gene and the molecular marker thereof are beneficial to breeding of rice varieties with strong low-temperature germination capacity, and as the identification of the low-temperature germination capacity of the rice needs specific low-temperature conditions and phenotype selection is difficult, the genotype of the low-temperature germination capacity can be accurately judged by screening the qLTG10 haplotype, the molecular marker provided by the invention performs genotype selection on low-generation breeding populations in the seedling stage, and accelerates the breeding process of low-temperature-resistant rice.

Description

technical field [0001] The invention belongs to the technical field of rice trait gene positioning, and in particular relates to a gene stably expressed for low-temperature germination ability of rice and its molecular marker and application. Background technique [0002] Rice is an important food crop, which is planted all over the world. More than half of the world's population uses rice as the main food. The traditional rice planting mode has cumbersome procedures, heavy labor, and low efficiency. At present, the rural labor force in China There is a serious shortage. Therefore, it is a development trend to develop light and simple production technology and vigorously develop agricultural mechanization. Because rice direct seeding saves the process of cultivating seedlings and transplanting seedlings in traditional rice planting, mechanization of seeding can be realized, and it has the characteristics of cost saving, time saving and labor saving. Therefore, it has attrac...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N15/29C12N15/11C12Q1/6895
CPCC07K14/415C12Q1/6895C12Q2600/13C12Q2600/156C12Q2600/172
Inventor杨梯丰周炼张少红刘斌赵均良董景芳
OwnerRICE RES INST GUANGDONG ACADEMY OF AGRI SCI