Gene for stably expressing low-temperature germination capacity of rice and molecular marker and application thereof
A low-temperature germination and molecular marker technology, which is applied in the fields of application, genetic engineering, and plant genetic improvement, can solve the problem that rice breeding is not being used efficiently, and achieve the effect of eliminating the phenotypic identification process and speeding up the breeding process
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0025] A gene mapping method for the stable expression of rice germination ability at low temperature:
[0026] 1. Select material
[0027] From the International Rice Research Institute, 1,568 rice germplasms with different origins and rich genetic diversity were introduced. Based on the genotype information of 700,000 molecular markers in the rice genome, 375 representative germplasms were selected for gene mapping;
[0028] 2. Genome-wide association analysis
[0029] The germplasm of 375 rice germplasms was evaluated at 13°C for low-temperature germination, and then the genotype information of 44,000 SNP molecular markers covering the whole genome that met the calculation requirements was used to conduct genome-wide association analysis through the software GAPIT V2 to identify control genes. The QTL interval of germination ability at low temperature, the threshold value of QTL identification is set at p-4 , 9 QTLs controlling germination ability at low temperature were d...
Embodiment 2
[0036] A tight-linked molecular marker of a gene stably expressed in rice germination ability at low temperature:
[0037] Linkage disequilibrium analysis by further chromosome segments, such as image 3 As shown, the interval range of qLTG10 is determined to be 11.551-11.780Mb;
[0038] Such as Figure 4 As shown, in the 11.551-11.780Mb interval of chromosome 10, there are two large structural variations at 11650kb and 11673kb, and these two variations show regularity in germplasms with strong low-temperature germination ability and weak low-temperature germination ability sex. Therefore, two pairs of molecular markers D22484 and 10ID1 were designed for these two structural differences, and the sequence information of the obtained molecular markers is as follows:
[0039]The forward primer sequence of D22484 is: CGACACTTGCACCATGAATTT;
[0040] The reverse primer sequence is: ATGGCTCTATCTTTGAATGTGC;
[0041] The forward primer sequence of 10ID1 is: TGTTCTGCGTCACCGACTT;
...
Embodiment 3
[0044] Application of tightly linked molecular markers for genes stably expressed at low temperature germination ability of rice:
[0045] According to the TAC and CGT haplotypes of qLTG10, 10 rice germplasms were selected respectively, and they were genotyped with the above two pairs of molecular markers. Figure 5 It can be seen from A that D22484 cannot amplify the product in the CGT haplotype germplasm, and it has a strong low-temperature germination allele, and can amplify a 259bp long product in the TAC type germplasm; in the CGT haplotype The amplified product of 10ID1 in the ploidy type germplasm was 176bp in length, which carried a strong low temperature germination ability allele, while the amplified product in the TAC type germplasm was 166bp in length.
[0046] Depend on Figure 5 It can be seen from B that the low-temperature germination ability of these 10 CGT haplotype germplasms is 74.7%-100%, and the average low-temperature germination ability is 92.1%; The ...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


